Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here for more information

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Free Full Text (Free PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Lee, S.-K.
Right arrow Articles by Kim, J.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.-K.
Right arrow Articles by Kim, J.-W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Clinical

A Novel Mutation in the DSPP Gene Associated with Dentinogenesis Imperfecta Type II

S.-K. Lee1,2, K.-E. Lee2, D. Jeon3, G. Lee3, H. Lee1, C.-U. Shin4, Y.-J. Jung4, S.-H. Lee4, S.-H. Hahn4 and J.-W. Kim1,2,4,*

1 Department of Cell and Developmental Biology, Dental Research Institute & BK21 program
2 Dental Genetics Laboratory
3 Laboratory of Molecular Genetics
4 Depart-ment of Pediatric Dentistry & Dental Research Institute, School of Dentistry, Seoul National University, 275-1 Yongon-dong, Chongno-gu, Seoul 110-768, Korea

Correspondence: * corresponding author, pedoman{at}snu.ac.kr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Hereditary dentin defects are divided into dentinogenesis imperfecta and dentin dysplasia. We identified a family segregating severe dentinogenesis imperfecta. The kindred spanned four generations and showed an autosomal-dominant pattern of inheritance. The proband was a child presenting with a severely affected primary dentition, with wide-open pulp chambers and multiple pulp exposures, resembling a DGI type III (DGI-III) pattern. We hypothesized that a mutation in the DSPP gene is responsible for this severe phenotype. Mutational analyses revealed a novel mutation (c.53T>A, p.V18D) near the intron-exon boundary in the third exon of the DSPP gene. We analyzed the effect of the mutation by means of an in vitro splicing assay, which revealed that the mutation did not affect pre-mRNA splicing. Further studies are needed for a better understanding of the nature of the disease and the development of an appropriate treatment strategy.

Key Words: dentin sialophosphoprotein • DSPP • dentinogenesis imperfecta • dentin dysplasia • splicing assay


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dentin matrix is secreted by odontoblasts in developing dental tooth germs following a series of interactions between the oral ectoderm and underlying neural-crest-derived ectomesenchyme. The dentin matrix mineralizes following its secretion. Subsequently, odontoblasts migrate toward the pulp, leaving odontoblast processes within the matrix (Thesleff, 2003). The resulting dentin has unique structural and mechanical properties. The mineral content and microhardness of dentin are between those of enamel and bone, allowing it to support enamel and to endure masticatory forces. Odontoblast processes organize the structure of the mineralized matrix into peritubular and intertubular regions and project cellular capabilities, such as the reception of sensory information and responses against noxious stimuli through the entire thickness of dentin and to the dentino-enamel junction (Torneck, 1998).

While hereditary conditions affecting dentin have long been observed, the term "hereditary opalescent dentin" was adopted to describe conditions of diseases consisting of only dental phenotypes (Hodge et al., 1936). Likewise, the term "dentinogenesis imperfecta" was introduced to describe the common dental phenotypes of osteogenesis imperfecta and hereditary opalescent dentin (Roberts and Schour, 1939).

The classification system currently in use recognizes 3 types of dentinogenesis imperfecta (DGI-I, DGI-II, and DGI-III) and 2 types of dentin dysplasia (DD-I and DD-II). The class distinctions vary according to the clinical phenotype, radiographic findings, and severity and were proposed in the report of a dentin dysplasia type II family (Shields et al., 1973). When this classification system was first published, a detailed genetic basis for these diseases was unknown, and thus, some have suggested that it may be necessary to update the nomenclature for hereditary dentin defects after the underlying genetic defects have been identified (Bixler, 1976; Dean et al., 1997).

Recent studies have shown that defects in the dentin sialophosphoprotein (DSPP) gene cause DGI-II (Xiao et al., 2001; Zhang et al., 2001; Kim et al., 2004; Malmgren et al., 2004; Holappa et al., 2006; McKnight et al., 2008; Song et al., 2008), DGI-III (Dong et al., 2005; Kim et al., 2005), and DD-II (Rajpar et al., 2002). To date, despite the existence of other candidate genes for hereditary dentin defects (Ye et al., 2004), no disease-causing mutations outside of the DSPP gene have been identified (Beattie et al., 2006).

In this study, we identified a family having severe dentinogenesis imperfecta, with features such as wide-open pulp chambers and multiple pulp exposures reported in DGI-III. We performed mutational analyses to identify the underlying molecular genetic etiology.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Enrollment of Human Participants
The protocols for the current study, as well as participant consents, were reviewed and approved by the Institutional Review Boards at Seoul National University Dental Hospital. Appropriate informed consent was obtained from all participants.

Primer Design, Polymerase chain-reaction (Pcr), and DNA sequencing
Genomic DNA was isolated from whole blood or buccal mucosal swabs with a conventional ‘salting out’ procedure, as previously described (Miller et al., 1988). Conditions for the PCR and the DNA sequences of the oligonucleotide primer pairs used for DSPP exon-specific PCR amplifications and DNA sequencing were as previously described (Beattie et al., 2006). PCR reactions covering exon and exon/intron boundaries of the first 4 exons and 5' part of exon 5 were performed with AccuPower taq DNA polymerase (Bioneer Life Science, Seoul, Korea). PCR amplification products were purified according to the protocol supplied with the PCRquick-spin PCR Product Purification Kit (iNtRON Biotechnology, Seoul, Korea). DNA sequencing was performed with an ABI Model 3730XL sequencer (Applied Biosystems, Foster City, CA, USA).

BamHI Digestion of Pcr Products
PCR reactions were performed for DNA samples of all participating family members. The size of the amplified product was 394 bp (sense, 5'-GTGTGCA CGCTCACACACAT-3'; antisense, 5'-CATTCCCTTC TCCCTTGTGA-3'). The mutation of interest, a T to A transversion, resulted in the generation of a BamHI restriction site (GGATCC) within the PCR product, and was identified when a 2-µL quantity of the PCR reaction was subjected to a restriction digest with 4U of BamHI. Reactions were incubated for 3 hrs at 37°C, and digestion products were separated by 2.5% agarose gel electrophoresis.

In vitro splicing Assay
Genomic DNA from a healthy control individual was amplified with pfu polymerase (Elpisbio, Seoul, Korea) with PCR primers (amplicon size, 5096 bp; sense, G GG GG C GG C CG CC TAA A CA G TG AT T GG TTGAG; antisense, AGGATCCATGATTTCACATA AGAC) to include exons 1, 2, 3, and 4 of the DSPP gene. The amplification product was cloned into the pTOP blunt V2 vector (Enzynomics, Seoul, Korea), and subsequently subcloned into the pSPL3 splicing vector after double-digestion with NotI and BamHI restriction endonucleases. PCR mutagenesis was performed to change T to A at the second nucleotide of exon 3 (c.53T>A). Normal and mutant pSPL3 vectors were transfected into COS-7 cells, and total RNA was isolated after 36 hrs. RT-PCR (sense, TATTTTTGCA TTTG GGCAGT; antisense, CCTACTTCTGCCCAC TTAGAGC primers) was performed with HiPi PCR premix (Elpisbio). Normally spliced mRNA product would result in an amplicon of 251 bp. RT-PCR product was purified and sequenced as described above.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Clinical Findings
The proband (IV:20) first presented at 2.5 yrs of age at the Pediatric Dental Clinic at Seoul National University Dental Hospital. At the time of presentation, the deciduous dentition displayed severe attrition and marked discoloration. Periapical inflammation was observed in several teeth in which the pulp tissue was exposed by attrition. However, a treatment appointment was missed, and the individual did not appear for an additional 2 yrs. The oral condition of the proband by age 4.5 yrs had markedly declined. Several teeth were missing, and the remaining teeth were worn down to their roots and exhibited pulpal pathology. Only a few lower anterior teeth were without exposure of pulp and still had dentin covering their occlusal surfaces (Fig. 1Go). The lower deciduous incisors (#71, 72, 82) had some, but not complete, pulpal obliteration, and somewhat wide pulp chambers were still present in the lower deciduous canines (Fig. 2Go).


Figure 1
View larger version (82K):
[in this window]
[in a new window]

 
Figure 1. Mutational analysis, gene structure, and clinical photographs. (A,B) DNA sequencing chromatogram of control and affected individuals. The red arrow indicates mutated nucleotide (g.1198T>A, c.53T>A). (C) Gene structure of DSPP and position of the mutation (c.53T>A). (D,E) Maxillary and mandibular clinical photographs of the proband (IV:20) at age 4.5 yrs. (F) Frontal photograph of the affected individual (IV:17) at age 19 yrs. (G) Frontal photograph of the affected individual (III:23) at age 31 yrs.

 

Figure 2
View larger version (115K):
[in this window]
[in a new window]

 
Figure 2. Dental panoramic radiographs. A)( Dental panoramic radiograph of the proband taken at the first visit at age 2.5 yrs. Widened pulp chambers and marked attrition of primary teeth were easily identifiable. (B) Dental panoramic radiograph of the proband taken at the first visit at age 4.5 yrs. (C) Dental panoramic radiograph of the affected individual (IV:17) at age 19 yrs. (D) Dental panoramic radiograph of the affected individual (III:23) at age 31 yrs.

 
For the purposes of this study, 27 family members were recruited, consisting of 15 affected and 12 unaffected members (Fig. 3Go). There was no history of bone fragility or symptoms of progressive hearing loss in the family. Most affected members were edentulous and wore complete dentures, although one member (III:23) had overdentures over root rests (Fig. 1GGo). The permanent teeth of affected members were also severely affected (IV:17, Fig. 1FGo).


Figure 3
View larger version (36K):
[in this window]
[in a new window]

 
Figure 3. Pedigree of the affected family and agarose gel electrophoresis image of BamHI restriction digest. (A) The pedigree of the family shows an autosomal-dominant inheritance pattern. Blackened symbols represent clinically affected individuals; the ‘plus’ symbol indicates members recruited for this study. Arrow denotes proband. (B) The BamHI recognition site was introduced by the mutation (c.53T>A), and the restriction product (white arrowhead) correlates with the presence of disease.

 
Mutation Results
Sequencing analysis revealed the existence of a T to A transversion in exon 3 (g.1198T>A, c.53T>A, and p.V18D, based on reference sequences NC_000004 and NM_104208) of the DSPP gene, and this sequence variation correlated perfectly with the presence of the disease (Fig. 3Go). Further, this sequence variation was not present in 100 unaffected control individuals from the Korean population (data not shown), suggesting that the mutation is not a common variant of the DSPP gene.

In vitro splicing assay of normal and mutated pSPL3 vectors showed a single band of normally spliced mRNA, which indicated that the mutation did not affect pre-mRNA processing (Fig. 4Go).


Figure 4
View larger version (39K):
[in this window]
[in a new window]

 
Figure 4. In vitro splicing assay. Diagram of genomic fragment inserted into the pSPL3 vector is shown with the positions of sense and antisense primers used in the RT-PCR. Exons are blocks numbered 1 through 4, and the introns are lines. The numbers of nucleotides in each exon and intron are shown below. RT-PCR analyses of normal (N) and mutated (M) pSPL3 splicing vector showed only one band of normal pre-mRNA splicing (251bp). The red arrows indicate the position of normal and mutated nucleotides.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The clinical phenotype in our proband was severe, with features reported in DGI-III. The DGI-III classification was developed to describe the dental phenotypes found in the Brandywine triracial isolate of Native American Indians, African Americans, and Caucasians of European decent in the USA. Clinically, the DGI-III-affected teeth varied in color and shape, like those described for DGI-I and DGI-II, but unlike these conditions, their deciduous teeth displayed multiple pulp exposures. Radiographically, the deciduous teeth showed considerable variation in appearance, ranging from total pulp obliteration, to normal, and even to shell-like teeth (Shields et al., 1973).

Multiple pulp exposures and shell-like teeth were the two main features previously used to distinguish DGI-III from DGI-II, but are no longer considered unique to DGI-III (Kim and Simmer, 2007). ‘Shell-like teeth’ was a phenotypic variation originally found in children of the Brandywine isolate (Witkop et al., 1966); however, pulp chambers in the primary dentitions of persons with DGI-II and of multiple ethnicities are initially abnormally wide, but progressively show obliteration (Heimler et al., 1985; Tanaka and Murakami, 1998; Sapir and Shapira, 2001). Overlap of the phenotypic features in DGI-II and DGI-III presumably relates to their similar genetic causes: The same mutation of the DSPP gene (c.52G>T) causes DGI-II and DGI-III in different families (Kim et al., 2005; Holappa et al., 2006; Song et al., 2006). Furthermore, dental phenotypes in this family provide additional evidence that DGI-III is not a distinct entity, but a slightly varied phenotype with a reduced rate of dentin formation in the early deciduous dentition.

The mutation (g.1198T>A, c.53T>A, p.V18D) identified in this family was located adjacent to a proposed mutational ‘hotspot’ (g.1197G>T, c.52G>T) in the DSPP gene, occurring at the second nucleotide of exon 3. The Valine residue at this position is conserved across known species, such as human (NP_055023), mouse (NP_034210), rat (NP_036922), and pig (NP_998942). Given the proximity to the border of exon 3, the mutation was suspected to have some influence on normal pre-mRNA splicing. However, in silico analysis of the effect of this mutation on the pre-mRNA splicing was not enough to accept it as a mutation affecting splicing. There were only small changes in the splice acceptor site prediction value (0.97->0.91, www.fruitfly.org/seq_tools/splice.html) and the prediction confidence value (0.26 -> 0.22, genome.cbs.dtu.dk/services/NetGene2/). We also checked possible disruption of the exonic splicing enhancer binding site using ESEfinder (rulai.cshl.edu/tools/ESE/index.html). However, the binding score of SC35 among the predicted serine/ arginine (SR) proteins changed from 2.41 to 2.69.

To verify the effect of the mutation on the pre-mRNA splicing, we performed an in vitro splicing assay. The result revealed that the mutation did not affect the pre-mRNA splicing process, as indicated by in silico analysis. We conclude that the result of the mutation in this study is unlikely to be aberrant pre-mRNA splicing, but rather the consequence of the amino acid change (Valine to Aspartic acid at the codon position 18).

Recently, it has been suggested that all the DSPP mutations reported in the DSP portion cause their phenotypes through disruption of signal peptide processing, resulting in interference with protein processing (McKnight et al., 2008). The novel mutation identified in this study replaced the otherwise-invariant Val18 with a hydrophilic Asp18 without an abnormal pre-mRNA splicing. It is possible that the signal peptide cleavage is impaired by this change. However, at this time, it is not known whether the signal peptide of the mutant protein is improperly processed and the mutant protein is accumulated in the odontoblast, or if the conserved Val18 is critical for proper DSPP folding or post-translational modification after signal peptide cleavage. It should be further investigated whether the mutant protein activates ER stress, which might affect other matrix protein processing (including DSPP itself) and/or cell function.

Proper genotype-phenotype correlations as well as correct diagnosis are essential for an understanding of the nature of disease as well as the development of treatment strategy in gene therapy. In this study, we were able to analyze the effect of the mutation with the help of an in vitro splicing assay. Identification of the disease-causing mutation and characterization of the molecular pathogenesis may lead us to a better understanding of this disease and the development of a novel strategy of disease modulation.


    ACKNOWLEDGMENTS
 
We thank all the family members for their cooperation. We thank Dr. Alessandro Stella, University of Bari, Italy, for the pSPL3 splicing vector used in this study. This research was supported by grant 03-2005-003 from the Seoul National University Dental Hospital Research Fund. We thank Dr. James Simmer for his careful review of this manuscript.

Received for publication February 15, 2007. Revision received September 24, 2008. Accepted for publication October 14, 2008.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Beattie ML, Kim JW, Gong SG, Murdoch-Kinch CA, Simmer JP, Hu JC (2006). Phenotypic variation in dentinogenesis imperfecta/dentin dysplasia linked to 4q21. J Dent Res 85:329–333.[Abstract/Free Full Text]
  • Bixler D (1976). Heritable disorders affecting dentin. In: Oral facial genetics. Stewart RE, Prescott GH, editors. St. Louis: C.V. Mosby Co., pp. 227–261.
  • Dean JA, Hartsfield JK Jr, Wright JT, Hart TC (1997). Dentin dysplasia, type II linkage to chromosome 4q. J Craniofac Genet Dev Biol 17: 172–177.[Medline] [Order article via Infotrieve]
  • Dong J, Gu T, Jeffords L, MacDougall M (2005). Dentin phosphoprotein compound mutation in dentin sialophosphoprotein causes dentinogenesis imperfecta type III. Am J Med Genet A 132:305–309.
  • Heimler A, Sciubba J, Lieber E, Kamen S (1985). An unusual presentation of opalescent dentin and Brandywine isolate hereditary opalescent dentin in an Ashkenazic Jewish family. Oral Surg Oral Med Oral Pathol 59:608–615.[Medline] [Order article via Infotrieve]
  • Hodge HC, Lose GB, Finn SB, Gachet FS, Bassett SH, Robb RC, et al. (1936). Correlated clinical and structural study of hereditary opalescent dentin. J Dent Res 15:316–317.
  • Holappa H, Nieminen P, Tolva L, Lukinmaa PL, Alaluusua S (2006). Splicing site mutations in dentin sialophosphoprotein causing dentinogenesis imperfecta type II. Eur J Oral Sci 114:381–384.[CrossRef][Medline] [Order article via Infotrieve]
  • Kim JW, Simmer JP (2007). Hereditary dentin defects. J Dent Res 86: 392–399.[Abstract/Free Full Text]
  • Kim JW, Nam SH, Jang KT, Lee SH, Kim CC, Hahn SH, et al. (2004). A novel splice acceptor mutation in the DSPP gene causing dentinogenesis imperfecta type II. Hum Genet 115:248–254.[Medline] [Order article via Infotrieve]
  • Kim JW, Hu JC, Lee JI, Moon SK, Kim YJ, Jang KT, et al. (2005). Mutational hot spot in the DSPP gene causing dentinogenesis imperfecta type II. Hum Genet 116:186–191.[CrossRef][Medline] [Order article via Infotrieve]
  • Malmgren B, Lindskog S, Elgadi A, Norgren S (2004). Clinical, histopathologic, and genetic investigation in two large families with dentinogenesis imperfecta type II. Hum Genet 114:491–498.[CrossRef][Medline] [Order article via Infotrieve]
  • McKnight DA, Hart SP, Hart TC, Hartsfield JK, Wilson A, Wright JT, et al. (2008). A comprehensive analysis of normal variation and disease-causing mutations in the human DSPP gene. Hum Mutat 29: 1392–1404.[Medline] [Order article via Infotrieve]
  • Miller SA, Dykes DD, Polesky HF (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215.[Free Full Text]
  • Rajpar MH, Koch MJ, Davies RM, Mellody KT, Kielty CM, Dixon MJ (2002). Mutation of the signal peptide region of the bicistronic gene DSPP affects translocation to the endoplasmic reticulum and results in defective dentine biomineralization. Hum Mol Genet 11:2559–2565.[Abstract/Free Full Text]
  • Roberts E, Schour I (1939). Hereditary opalescent dentine (dentinogenesis imperfecta). Am J Orthod Oral Surg 25:267–276.
  • Sapir S, Shapira J (2001). Dentinogenesis imperfecta: an early treatment strategy. Pediatr Dent 23:232–237.[Medline] [Order article via Infotrieve]
  • Shields ED, Bixler D, el-Kafrawy AM (1973). A proposed classification for heritable human dentine defects with a description of a new entity. Arch Oral Biol 18:543–553.[CrossRef][Medline] [Order article via Infotrieve]
  • Song Y, Wang C, Peng B, Ye X, Zhao G, Fan M, et al. (2006). Phenotypes and genotypes in 2 DGI families with different DSPP mutations. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 102:360–374.[CrossRef][Medline] [Order article via Infotrieve]
  • Song YL, Wang CN, Fan MW, Su B, Bian Z (2008). Dentin phosphoprotein frameshift mutations in hereditary dentin disorders and their variation patterns in normal human population. J Med Genet 45:457–464.[Abstract/Free Full Text]
  • Tanaka T, Murakami T (1998). Radiological features of hereditary opalescent dentin. Dentomaxillofac Radiol 27:251–253.[Abstract]
  • Thesleff I (2003). Epithelial-mesenchymal signalling regulating tooth morphogenesis. J Cell Sci 116(Pt 9):1647–1648.[Free Full Text]
  • Torneck CD (1998). Dentin-pulp complex. In: oral histology development, structure, and function. Ten Cate AR, editor. St. Louis, MO, USA: Mosby-Year Book, pp. 150–196.
  • Witkop CJ Jr, MacLean CJ, Schmidt PJ, Henry JL (1966). Medical and dental findings in the Brandywine isolate. AL J Med Sci 3:382–403.
  • Xiao S, Yu C, Chou X, Yuan W, Wang Y, Bu L, et al. (2001). Dentinogenesis imperfecta 1 with or without progressive hearing loss is associated with distinct mutations in DSPP. Nat Genet 27:201–204.[CrossRef][Medline] [Order article via Infotrieve]
  • Ye L, MacDougall M, Zhang S, Xie Y, Zhang J, Li Z, et al. (2004). Deletion of dentin matrix protein-1 leads to a partial failure of maturation of predentin into dentin, hypomineralization, and expanded cavities of pulp and root canal during postnatal tooth development. J Biol Chem 279:19141–19148.[Abstract/Free Full Text]
  • Zhang X, Zhao J, Li C, Gao S, Qiu C, Liu P, et al. (2001). DSPP mutation in dentinogenesis imperfecta Shields type II. Nat Genet 27:151–152.[CrossRef][Medline] [Order article via Infotrieve]

Journal of Dental Research, Vol. 88, No. 1, 51-55 (2009)
DOI: 10.1177/0022034508328168


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Free Full Text (Free PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Lee, S.-K.
Right arrow Articles by Kim, J.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, S.-K.
Right arrow Articles by Kim, J.-W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?