Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here for more information

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Free Full Text (Free PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Kaneko, T.
Right arrow Articles by Suda, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaneko, T.
Right arrow Articles by Suda, H.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Antigen-presenting Cells in Human Radicular Granulomas

T. Kaneko1,2,*, T. Okiji3, R. Kaneko1, J.E. Nör2 and H. Suda1

1 Pulp Biology and Endodontics, Graduate School, Tokyo Medical and Dental University, Yushima 1-5-45, Bunkyo-Ku, Tokyo, 113-8549, Japan;
2 Cariology, Restorative Sciences, and Endodontics, School of Dentistry, University of Michigan, Ann Arbor, MI, USA; and
3 Division of Cariology, Operative Dentistry and Endodontics, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan

Correspondence: * corresponding author, tomoendo{at}tmd.ac.jp


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Substantial numbers of dendritic cells have been detected in radicular granulomas. To test the hypothesis that local antigen presentation from dendritic cells to T-cells is involved critically in immunological responses within radicular granulomas, we compared characteristics of dendritic cells and macrophages by morphological and biological analyses. Under light microscopy, HLA-DR+ and CD68+ cells showed diverse profiles, including dendritic-shaped cells. Transmission electron microscopy revealed that HLA-DR+ dendritic cells, with long cytoplasmic processes and lacking distinct phagosomes, were concentrated in the lymphocyte-rich area. HLA-DR alpha-chain, CD83, and CD86 mRNAs from HLA-DR+ dendritic cells, and CD28 mRNA from CD28+ T-cells were up-regulated in lymphocyte-rich area. Scanning electron microscopy demonstrated that the density of gold particles on dendritic cells was higher than that on HLA-DR+ macrophages. These results suggest that dendritic cells in radicular granulomas are associated with local defense reactions as stronger antigen-presenting cells, as compared with macrophages.

Key Words: dendritic cell • HLA-DR • transmission electron microscopy • scanning electron microscopy • macrophage


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Apical periodontitis, in the form of radicular granulomas and cysts, is caused by local defense reactions against chronic bacterial infection from the infected and necrotic root canals (Nair, 2004). These inflammatory lesions consist of granulation and fibrous tissues containing a variety of inflammatory/immunocompetent cells, such as macrophages, lymphocytes, and plasma cells (Tani et al., 1992; Wallstrom et al., 1993; Torabinejad, 1994; Liapatas et al., 2003). Some studies have reported that T-cells outnumber B-cells (Stashenko et al., 1992), suggesting that T-cell-mediated immunological reactions play a major role in the development of the lesions. Among non-lymphoid cells, involvement of macrophages in the pathogenesis of these lesions has been postulated. These cells may play some triggering role in lesion expansion by producing cytokines such as interleukin-1 (Artese et al., 1991; Stashenko et al., 1992) and nitric oxide (Suzuki et al., 1999). Moreover, a considerable proportion of macrophages in the lesion may express major histocompatibility complex (MHC) class II molecules (Köpp et al., 1989; Suzuki et al., 1999), suggesting that they may contribute to lesion development through activation of T-cell-mediated immune responses, by acting as antigen-presenting cells.

Our recent studies have demonstrated the presence of dendritic cells in experimentally induced rat apical periodontitis (Kaneko et al., 2001a,b, 2008). Dendritic cells express, constitutively, a high level of MHC class II molecules and act as professional antigen-presenting cells that play a pivotal role in initiating and regulating primary and secondary immune responses through the activation of T-cells (Steinman, 1991; Banchereau and Steinman, 1998). We have found that dendritic cells in rat periodontitis can be discriminated from macrophages by their ultrastructural appearances (Kaneko et al., 2001b, in press). These dendritic cells are prevalent in the chronic, post-expansion stage of lesion development. As for human radicular granulomas, few studies of dendritic cells are available (Gao et al., 1988; Lukic et al., 2006), and the ultrastructure and precise identification of dendritic cells have not yet been reported.

In this study, we investigated several characteristics of dendritic cells in human radicular granulomas, to test the hypothesis that local antigen presentation from dendritic cells to T-cells is involved critically in immunological responses within radicular granulomas. Following HLA-DR immunostaining, we used transmission electron microscopy (TEM) to examine the morphology and distribution of dendritic cells. We also performed gene expression analysis for HLA-DR alpha-chain, CD28, CD83, CD86, and CD163, by laser capture microdissection and reverse-transcription-PCR (RT-PCR), to demonstrate that the expression levels are up-regulated within potential sites of local antigen presentation. We further conducted scanning electron microscopy (SEM) on sections colloidal-gold-immunolabeled for HLA-DR, to test if dendritic cells are efficient antigen-presenting cells in the lesions.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We examined 14 human radicular granulomas from 14 individuals who had a non-contributory medical history and were taking no medication. Periapical tissues were obtained under institutionally approved protocols and after informed consent had been obtained. All of the specimens showed radiographic signs of apical periodontitis, i.e., clear radiolucency and disappearance of the periodontal ligament space, and were diagnosed as radicular granuloma according to the histological examination of hematoxylin- and eosin-stained sections. These specimens (n = 14) were cut into 2 pieces, one for immunohistochemistry, TEM, and laser capture RT-PCR, and the other for SEM.

Immunohistochemistry and TEM
The specimens were fixed with 2% paraformaldehyde containing picric acid. Frozen sections were prepared, and were incubated with one of the following monoclonal antibodies: anti-HLA-DR (DAKO, Glostrup, Denmark); CD68 (DAKO; reactive to dendritic cells and macrophages); CD3 (DAKO; a pan T-cell antibody), or CD28 (Becton Dickinson, Franklin Lakes, NJ, USA; reactive to most mature T-cells). This was followed by sequential incubations with a biotinylated anti-mouse IgG (Vector Laboratories, Burlingame, CA, USA) and avidin-biotin-peroxidase complex (Elite ABC kit; Vector). The peroxidase activity was developed with a diaminobenzidine-H2O2 solution (DAB substrate kit; Vector). Sections of the gingiva, processed in the same way, served as positive controls.

Using light microscopy, we counted immmnopositive cells and total numbers of nucleated cells in the whole area of each section, and then calculated the frequency of immunopositive cells.

For TEM analysis, the sections were stained with the anti-HLA-DR antibody in a manner similar to that described above. After being stained, the sections were post-fixed, dehydrated, and embedded in Epon. Ultrathin sections were cut with an ultramicrotome (Reichert Ultracut-N; Reichert-Nissei, Tokyo, Japan), and examined in a TEM (H7100; Hitachi, Tokyo, Japan).

Under TEM, all positively stained cells in the whole area of trimmed samples were classified into dendritic cells or macrophages, as described previously (Zhao et al., 2006). The same analysis was also done in lymphocyte-rich areas, where more than 15 lymphocytes were seen in a grid (150 x 150 µm). The frequency of each type of cell was expressed as a percentage. Some cells showed morphology intermediate between that of macrophages and dendritic cells, such as a round profile without distinct phagosomes and cytoplasmic processes. These cells were classified as "unidentified".

Laser-capture Microdissection and RT-PCR
The frozen tissue sections were mounted on glass slides (Leica, Heidelberg, Germany). Immunostaining was performed for HLA-DR or CD28, as described previously (Kaneko et al., 2007). HLA-DR+ cells in each lymphocyte-rich area and the surrounding tissues were randomly selected under a light microscope at 20x magnification. At higher magnification (63x), these were classified as: (i) type I cells, characterized by long cytoplasmic processes and lack of distinct vacuoles (mostly composed of dendritic cells according to the TEM analysis); (ii) type II cells, characterized by distinct phagosome-like vacuoles and lack of long cytoplasmic processes (mostly composed of macrophages); or (iii) unidentified cells. Type I, type II, and CD28+ cells (30 cells each) were dissected and collected separately by means of a microdissection microscope (Leica AS LMD). Total RNA was extracted, and, as we described previously (Kaneko et al., 2007), cDNA synthesis and PCR amplification were done in single tubes, with simultaneous use of the primer set for the gene of interest and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer set, with the use of SuperScript one-step RT-PCR and a Platinum Taq kit (Invitrogen, Carlsbad, CA, USA). PCR amplification of the products was performed with the following primers: HLA-DR alpha-chain, CAAAGAAGGAGACGGTCTGG (sense) and GGCTCTCTCAGTTCCACAGG (antisense); CD28, GCTGCTCTTGGCTCTCAACT (sense) and ACCTGAAGCTGCT GGGAGTA (antisense); CD163, CGAGTTAACGCCAGTAAGG (sense) and GAACATGTCACGCCAGC (antisense); CD83, CTGGTCAACCTCCTGGACAT (sense) and CGTAAAACATCT GGGCTGGT (antisense); CD86, AGATGTCCTACGGGAACGTG (sense) and ATCCCACCTTAGAGCCAGGT (antisense); GAPDH, CATGGCCTCCAAGGAGTAAG (sense) and AGGGGTCTACA GGCAACTG (antisense).

SEM
The specimens were fixed with 1% paraformaldehyde. Sections were cut with a linear slicer (PRO7 Dosaka EM, Kyoto, Japan), and incubated with anti-HLA-DR antibody, followed by anti-mouse IgG conjugated with 30-nm colloidal gold particles. They were post-fixed, dehydrated, dried, and sputter-coated with osmium in an ion coater (IB-5, EIKO Engineering, Tokyo, Japan). Back-scattered electrons were detected with the use of an Yttrium-Aluminum-Garnet back-scattered detector (Hitachi, Tokyo, Japan). Pairs of the secondary and the back-scattered electron images were observed under a SEM (S-4500, Hitachi). Using back-scattered electron imaging, we randomly selected 10 HLA-DR+ cells from each sample. According to the results from TEM analysis, we classified HLA-DR+ cells into cells with and those without long cytoplasmic processes (referred to as dendritic cells and macrophages, respectively), under the secondary electron image of SEM. We counted the number (per 150 nm x 100 nm) of gold particles on the cytoplasmic membrane of HLA-DR+ cells under the back-scattered electron image.

Statistical Analysis
Statistical analysis was made by a Wilcoxon paired-sample test, or by Kruskal-Wallis non-parametric ANOVA, followed by the Mann-Whitney U test with Bonferroni correction. A difference at the 5% level was accepted as significant.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Light Microscopy
Numerous HLA-DR+ (Figs. 1A, 1BGo), CD68+ (Figs. 1C, 1DGo), CD3+, and CD28+ cells were distributed in all portions of the lesion. HLA-DR+ and CD68+ cells showed membrane and cytoplasmic staining, respectively, and showed diverse profiles. HLA-DR+ cells with dendritic and spindle profiles were mainly distributed in the lymphocyte-rich area (Fig. 1BGo). CD68+ cells were classified into 2 populations according to their staining pattern. One type was rich in immunopositive cytoplasmic structures (Fig. 1CGo). Most CD68+ cells belonged to this type. Another type of cells showed the immunopositive structures in restricted areas within the cytoplasm (Fig. 1DGo). The latter type of cells usually showed a dendritic or spindle profile (Fig. 1DGo). The cell count for CD3+ T-cells was highest, and the count for CD68+ cells was lowest (Fig. 1EGo). The counts for CD3+ and CD28+ cells were not significantly different (Fig. 1EGo).


Figure 1
View larger version (65K):
[in this window]
[in a new window]

 
Figure 1. Immune cells in radicular granulomas. (A) A light micrograph of HLA-DR+ cells showing various profiles in radicular granuloma. Bar = 100 µm. (B) Higher magnification of the boxed area in (A). HLA-DR+ cells show dendritic (arrow) and spindle (arrowheads) profiles. These cells show cell-to-cell contacts with lymphocyte-like small round cells with a round nucleus. Bar = 50 µm. (C) A CD68+ cell showing an oval profile. This cell contains dense immunoreaction products in the cytoplasm. Bar = 30 µm. (D) A CD68+ cell showing a spindle profile with long cytoplasmic possesses. This cell contains sparse intracytoplasmic immunoreaction products. Bar = 30 µm. (E) Frequency of HLA-DR-, CD68-, CD3-, and CD28-positive cells in radicular granulomas. Results are expressed as mean ± SD (n=14 each). *p < 0.05 and **p < 0.01.

 
TEM Analysis
Under TEM, most HLA-DR+ cells were classified as either macrophages (Fig. 2AGo) or dendritic cells (Fig. 2BGo). Macrophages typically showed an oval, round, or irregular large cell body with short cytoplasmic processes, and were discriminated from dendritic cells by their distinct phagosomes within the cytoplasm (Fig. 2AGo). In contrast, dendritic cells normally showed a slender, spindle, or dendritic profile, possessed long cytoplasmic processes, and contained numerous tubules/vesicles, a relatively smaller quantity of lysosomes (Fig. 2BGo), and no distinct phagosomes. Although the percentage of HLA-DR+ macrophages in the total area was significantly higher than that of dendritic cells (Fig. 2CGo), dendritic cells significantly outnumbered HLA-DR+ macrophages in the lymphocyte-rich area (Fig. 2DGo).


Figure 2
View larger version (88K):
[in this window]
[in a new window]

 
Figure 2. TEM analysis of HLA-DR+ dendritic cells and HLA-DR+ macrophages in radicular granulomas. (A) An HLA-DR+ macrophage. Large distinct phagosomes (*) can be seen. Bar = 3 µm. (B) Ultrastructure of an HLA-DR+ dendritic cell with a long cytoplasmic process in a lymphocyte (Ly)-rich area. Bar = 1.8 µm. (C) Frequency of HLA-DR+ dendritic cells and macrophages in the total area of the specimen (mean ± SD; n = 14). **p < 0.01. (D) Frequency of HLA-DR+ dendritic cells and macrophages in lymphocyte-rich areas (mean ± SD; n = 14). **p < 0.01.

 
RT-PCR
Gene expression levels of CD83 and CD163 were up-regulated in type I and type II cells, respectively (Fig. 3Go). Type I cells showed a greater up-regulation of HLA-DR alpha-chain and CD86 mRNAs as compared with type II cells. HLA-DR alpha-chain, CD83, and CD86 mRNA levels were highest in type I cells retrieved from lymphocyte-rich areas, and lowest in type II cells from the surrounding tissues. Conversely, CD163 mRNA was highest in type II cells from the surrounding tissues, and lowest in type I cells from lymphocyte-rich areas. We have also observed the up-regulation of CD28 mRNA in CD28+ T-cells in lymphocyte-rich areas.


Figure 3
View larger version (46K):
[in this window]
[in a new window]

 
Figure 3. RT-PCR to evaluate HLA-DR alpha-chain, CD83, CD86, and CD163 mRNA expression levels in type I and type II HLA-DR+ cells, and CD28 mRNA in CD28+ cells in lymphocyte-rich areas and the surrounding tissues. The densities of the bands corresponding to HLA-DR alpha-chain, CD83, CD86, CD163, and CD28 mRNA were measured with the Image J software (Version 1.37v, NIH, Bethesda, MD, USA), normalized against the density of the bands for GAPDH, and described numerically.

 
SEM Analysis
By means of back-scattered electron imaging, immunopositive cells labeled with gold particles were identified with high contrast to the background. Using secondary electron imaging, we classified these HLA-DR+ cells into cells without long cytoplasmic processes (macrophages, Figs. 4A, 4BGo) and those with long cytoplasmic processes (dendritic cells, Figs. 4C, 4DGo). The density of gold particles on HLA-DR+ dendritic cells was significantly higher than that on HLA-DR+ macrophages (P < 0.01) (Fig. 4EGo).


Figure 4
View larger version (72K):
[in this window]
[in a new window]

 
Figure 4. SEM analysis of dendritic cells and macrophages in radicular granulomas. (A) Secondary electron image showing an HLA-DR+ oval cell without cytoplasmic processes (macrophage). Bar = 5 µm. (B) Backscattered electron image of the same cell in (A). Bar = 5 µm. (C) Secondary electron image showing an HLA-DR+ slender cell with long cytoplasmic processes (dendritic cell). Bar = 5 µm. (D) Back-scattered electron image of the same cell in (C). This cell contains more gold particles as compared with the cell shown in (B). Bar = 5 µm. (E) Density of colloidal gold particles on HLA-DR+ dendritic cells and macrophages per unit area (150 nm x 100 nm). Results are expressed as mean ± SD (n = 14). **p < 0.01.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, identification of dendritic cells was made in human radicular granulomas. Light microscopy revealed that these cells may express HLA-DR and/or CD68, although complete identification was not possible without the use of electron microscopy. Under TEM, dendritic cells were discriminated from macrophages, since these cells had long cytoplasmic processes, but lacked distinct phagosomes. These ultrastructural features are very similar to those we have described earlier for dendritic cells in rats (Kaneko et al., 2001a,b, 2008).

The TEM analysis disclosed that dendritic cells in human radicular granulomas were mainly distributed in lymphocyte-rich areas, where their number was significantly greater than that of HLA-DR+ macrophages. This finding suggests that dendritic cells, not macrophages, primarily contribute to the local interaction with T-cells within the lesion. Such a tendency has also been seen in rat lesions at the chronic, post-expansion stage (Kaneko et al., 2008).

To confirm if dendritic cells and macrophages were selectively retrieved from the samples, we performed RT-PCR for CD83 and CD163. In humans, CD83 expression is a hallmark of mature and activated dendritic cells (Zhou and Tedder, 1995; Cao et al., 2005). CD163 is a marker for monocyte/macrophage lineage cells, and is highly expressed in tissue macrophages (Law et al., 1993; Schaer et al. 2005). The expression of CD83 and CD163 in monocyte-derived dendritic cells is up-regulated and down-regulated, respectively, during differentiation and maturation (Laudanski et al., 2007; Wang et al., 2007). Notably, CD83 and CD163 mRNA was up-regulated in group I and group II, respectively.

The expression level of a MHC class II molecule correlates with antigen-presenting cell activity (Cella et al., 1997; Villadangos et al., 2001; Wilson et al., 2004). In this point of view, we hypothesized that genes related to antigen-presenting cells, such as HLA-DR alpha-chain, CD83, and CD86, should be up-regulated in lymphocyte-rich areas, where dendritic cells are concentrated. CD86 is expressed on professional antigen-presenting cells to provide a critical signal for T-cell activation (Azuma et al., 1993). Indeed, these genes from type I cells were up-regulated to a greater extent than those from type II cells. Furthermore, expression of these genes was higher in type I cells retrieved from lymphocyte-rich areas compared with those from surrounding tissues. Analysis of these data suggests that dendritic cells in lymphocyte-rich areas may play the most active role in antigen presentation.

CD28 interactions with CD80 and/or CD86 are essential for initiating antigen-specific T-cell responses, up-regulating cytokine expression, and promoting T-cell expansion and differentiation (Bluestone, 1995). In granulomas, co-stimulatory signals provided by the interaction of CD28 on T-cells with CD80 and/or CD86 are essential for the activation of T helper lymphocytes and granuloma formation (King et al., 1996). Our light microscopic observation revealed that the majority of T-cells may express CD28, distributed in all areas of the lesion. But, notably, CD28 mRNA from CD28+ cells was up-regulated in lymphocyte-rich areas. This result suggests that co-stimulation between antigen-presenting cells and T-cells is enhanced in the lymphocyte-rich area.

For further confirmation of whether dendritic cells play the most active role as antigen-presenting cells, SEM on colloidal-gold-immunolabeled sections was carried out. Colloidal gold has been used as an excellent marker for studies in cell biology (Manara et al., 1990; Stoffel and Friess, 2002), and its high electron-density makes it useful for immunoelectron microscopy applications (Namork, 1989; Arimilli et al., 2000). This study clearly showed a significantly higher density of gold particles on cells with dendritic morphology (dendritic cells), compared with cells with oval morphology (macrophages).

Taken together, these results suggested that mature and activated dendritic cells were mainly distributed and acted as antigen presentation against T-cells in lymphocyte-rich areas of radicular granulomas. Our results also support the notion that dendritic cells act as efficient antigen-presenting cells, as compared with macrophages.


    ACKNOWLEDGMENTS
 
This study was supported by Grants-in-Aid for Scientific Research (Nos. 11470402 and 19659496 to T.O., and Nos. 15791091 and 18791393 to T.K.) from the Japan Society for the Promotion of Sciences.

Received for publication September 19, 2007. Revision received January 15, 2008. Accepted for publication February 5, 2008.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Arimilli S, Deshpande S, Nag B (2000). Localization of soluble major histocompatibility class II-peptide complexes on T cell surface. Microsc Res Tech 50:419–424.[Medline] [Order article via Infotrieve]
  • Artese L, Piattelli A, Quaranta M, Colasante A, Musani P (1991). Immunoreactivity for interleukin 1-beta and tumor necrosis factor-alpha and ultrastructural features of monocytes/macrophages in periapical granulomas. J Endod 17:483–487.[Medline] [Order article via Infotrieve]
  • Azuma M, Ito D, Yagita H, Okumura K, Phillips JH, Lanier LL, et al. (1993). B70 antigen is a second ligand for CTLA-4 and CD28. Nature 366:76–79.[CrossRef][Medline] [Order article via Infotrieve]
  • Banchereau J, Steinman RM (1998). Dendritic cells and the control of immunity. Nature 392:245–252.[CrossRef][Medline] [Order article via Infotrieve]
  • Bluestone JA (1995). New perspectives of CD28-B7-mediated T cell costimulation. Immunity 2:555–559.[CrossRef][Medline] [Order article via Infotrieve]
  • Cao W, Lee SH, Lu J (2005). CD83 is preformed inside monocytes, macrophages and dendritic cells, but it is only stably expressed on activated dendritic cells. Biochem J 385(Pt 1):85–93.[CrossRef][Medline] [Order article via Infotrieve]
  • Cella M, Engering A, Pinet V, Pieters J, Lanzavecchia A (1997). Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782–787.[CrossRef][Medline] [Order article via Infotrieve]
  • Gao Z, Mackenzie IC, Rittman BR, Korszun AK, Williams DM, Cruchley AT (1988). Immunocytochemical examination of immune cells in periapical granulomata and odontogenic cysts. J Oral Pathol 17:84–90.[Medline] [Order article via Infotrieve]
  • Kaneko T, Okiji T, Kan L, Suda H, Takagi M (2001a). An immunoelectron microscopic study of class II major histocompatibility complex molecule-expressing macrophages and dendritic cells in experimental rat periapical lesions. Arch Oral Biol 46:713–720.[Medline] [Order article via Infotrieve]
  • Kaneko T, Okiji T, Kan L, Takagi M, Suda H (2001b). Ultrastructural analysis of MHC class II molecule-expressing cells in experimentally-induced periapical lesions in the rat. J Endod 27:337–342.[Medline] [Order article via Infotrieve]
  • Kaneko T, Zhang Z, Mantellini M, Karl E, Zeitlin B, Verhaegen M, et al. (2007). Bcl-2 orchestrates a crosstalk between endothelial and tumor cells that promotes tumor growth. Cancer Res 67:9685–9693.[Abstract/Free Full Text]
  • Kaneko T, Okiji T, Zhao LY, Esgeurra RL, Suda H (2008). Heterogeneity of dendritic cells in rat apical periodontitis. Cell Tissue Res 331:617–623.[Medline] [Order article via Infotrieve]
  • King CL, Xianli J, June CH, Abe R, Lee KP (1996). CD28-deficient mice generate an impaired Th2 response to Schistosoma mansoni infection. Eur J Immunol 26:2448–2455.[Medline] [Order article via Infotrieve]
  • Köpp W, Schwarting R (1989). Differentiation of T lymphocyte subpupulations, macrophages and HLA-DR-restricted cells of apical granulation tissue. J Endod 15:72–75.[Medline] [Order article via Infotrieve]
  • Laudanski K, De A, Miller-Graziano C (2007). Exogenous heat shock protein 27 uniquely blocks differentiation of monocytes to dendritic cells. Eur J Immunol 37:2812–2824.[Medline] [Order article via Infotrieve]
  • Law SK, Micklem KJ, Shaw JM, Zhang XP, Dong Y, Willis AC, et al. (1993). A new macrophage differentiation antigen which is a member of the scavenger receptor superfamily. Eur J Immunol 23:2320–2325.[Medline] [Order article via Infotrieve]
  • Liapatas S, Nakou M, Rontogianni D (2003). Inflammatory infiltrate of chronic periradicular lesions: an immunohistochemical study. Int Endod J 36:464–471.[Medline] [Order article via Infotrieve]
  • Lukic A, Vasilijic S, Majstorovic I, Vucevic D, Mojsilovic S, Gazivoda D, et al. (2006). Characterization of antigen-presenting cells in human apical periodontitis lesions by flow cytometry and immunocytochemistry. Int Endod J 39:626–636.[Medline] [Order article via Infotrieve]
  • Manara GC, Soligo D, Lambertenghi-Deliliers G, Ferrari C, De Panfilis G (1990). Immunogold scanning electron microscopy applied to the study of Langerhans cells immunophenotype. Dermatologica 180:141–145.[Medline] [Order article via Infotrieve]
  • Nair PN (2004). Pathogenesis of apical periodontitis and the causes of endodontic failures. Crit Rev Oral Biol Med 15:348–381.[Abstract/Free Full Text]
  • Namork E, Meier HE (1989). Silver enhancement of gold probes (5–40 nm): single and double labeling of antigenic sites on cell surfaces imaged with backscattered electrons. J Electron Microsc Tech 11:102–108.[Medline] [Order article via Infotrieve]
  • Schaer DJ, Schleiffenbaum B, Kurrer M, Imhof A, Bächli E, Fehr J, et al. (2005). Soluble hemoglobin-haptoglobin scavenger receptor CD163 as a lineage-specific marker in the reactive hemophagocytic syndrome. Eur J Haematol 74:6–10.[CrossRef][Medline] [Order article via Infotrieve]
  • Stashenko P, Yu SM, Wang CY (1992). Kinetics of immune cell and bone resorptive responses to endodontic infections. J Endod 18:422–426.[Medline] [Order article via Infotrieve]
  • Steinman RM (1991). The dendritic cell system and its role in immunogenicity. Annu Rev Immunol 9:271–296.[CrossRef][Medline] [Order article via Infotrieve]
  • Stoffel MH, Friess AE (2002). Demonstration and cytochemical analysis of anionic sites on ejaculated boar spermatozoa: a scanning electron microscopy study using cationised colloidal gold. Histochem Cell Biol 117:61–67.[CrossRef][Medline] [Order article via Infotrieve]
  • Suzuki N, Okiji T, Suda H (1999). Enhanced expression of activation-associated molecules on macrophages of heterogeneous populations in expanding periapical lesions in rat molars. Arch Oral Biol 44:67–79.[CrossRef][Medline] [Order article via Infotrieve]
  • Tani N, Osada T, Watanabe Y, Umemoto T (1992). Comparative immunohistochemical identification and relative distribution of immunocompetent cells in sections of frozen or formalin-fixed tissue from human periapical inflammatory lesions. Endod Dent Traumatol 8:163–169.[Medline] [Order article via Infotrieve]
  • Torabinejad M (1994). Mediators of acute and chronic periradicular lesions. Oral Surg Oral Med Oral Pathol 78:511–521.[Medline] [Order article via Infotrieve]
  • Villadangos JA, Cardoso M, Steptoe RJ, van Berkel D, Pooley J, Carbone FR, et al. (2001). MHC class II expression is regulated in dendritic cells independently of invariant chain degradation. Immunity 14:739–749.[CrossRef][Medline] [Order article via Infotrieve]
  • Wallstrom JB, Torabinejad M, Kettering J, McMillan P (1993). Role of T cells in the pathogenesis of periapical lesions. A preliminary report. Oral Surg Oral Med Oral Pathol 76:213–218.[CrossRef][Medline] [Order article via Infotrieve]
  • Wang YS, Chi KH, Liao KW, Liu CC, Cheng CL, Lin YC, et al. (2007). Characterization of canine monocyte-derived dendritic cells with phenotypic and functional differentiation. Can J Vet Res 71:165–174.[Medline] [Order article via Infotrieve]
  • Wilson NS, El-Sukkari D, Villadangos JA (2004). Dendritic cells constitutively present self antigens in their immature state in vivo and regulate antigen presentation by controlling the rates of MHC class II synthesis and endocytosis. Blood 103:2187–2195.[Abstract/Free Full Text]
  • Zhao LY, Kaneko T, Okiji T, Takagi M, Suda H (2006). Immunoelectron microscopic analysis of CD11c-positive dendritic cells in the periapical region of the periodontal ligament of rat molars. J Endod 32:1164–1167.[Medline] [Order article via Infotrieve]
  • Zhou LJ, Tedder TF (1995). Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily. J Immunol 154:3821–3835.[Abstract]

Journal of Dental Research, Vol. 87, No. 6, 553-557 (2008)
DOI: 10.1177/154405910808700617


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Free Full Text (Free PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Kaneko, T.
Right arrow Articles by Suda, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaneko, T.
Right arrow Articles by Suda, H.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?