|
Sign In to gain access to subscriptions and/or personal tools.
|
Mandibular Appliance Modulates Condylar Growth through Integrins
M. Rubia Marques1,
D. Hajjar1,
K. Gomes Franchini2,
A. Sigari Moriscot1 and
M. Fagundes Santos1,*
1 Department of Cell and Developmental Biology, Institute of Biomedical Sciences, University of São Paulo, Av. Prof. Lineu Prestes 1524, CEP 05508-000, São Paulo, SP, Brazil; and
2 Department of Internal Medicine, School of Medicine, State University of Campinas, R. Alexander Fleming 40, CEP 13083-970, Campinas, SP, Brazil
Correspondence: * corresponding author, mfsantos{at}usp.br
 |
ABSTRACT
|
|---|
Functional orthopedic therapy corrects growth discrepancies between the maxilla and mandible, possibly through postural changes in the musculature and modulation of the mandibular condylar cartilage growth. Using Wistar rats, we tested the hypothesis that chondrocytes respond to forces generated by a mandibular propulsor appliance by changes in gene expression, and that integrins are important mediators in this response. Immunohistochemical analyses demonstrated that the use of the appliance for different periods of time modulated the expression of fibronectin,  5 and v integrin subunits, as well as cell proliferation in the cartilage. In vitro, cyclic distension of condylar cartilage-derived cells increased fibronectin mRNA, as well as Insulin-like Growth Factor-I and II mRNA and cell proliferation. A peptide containing the Arginine-Glycine-Asparagine sequence (RGD), the main cell-binding sequence in fibronectin, blocked almost all these effects, confirming that force itself modulates the growth of the rat condylar cartilage, and that RGD-binding integrins participate in mechanotransduction.
Key Words: cartilage • IGF • fibronectin • mechanical force
|
INTRODUCTION
|
|---|
Functional orthopedic appliances are largely used in dental clinics to correct malocclusions and facial growth discrepancies. These appliances indirectly exert mechanical forces on the condylar cartilage, an important growth site in the mandible, and it is believed that these forces might modulate condylar growth. The molecular mechanisms involved in this therapy, however, are not completely understood.
Previous studies from this laboratory showed that a mandibular propulsive appliance increases cell proliferation, insulin-like growth factors I and II (IGF-I and IGF-II), and collagen-binding integrin expression in the condylar cartilage of young rats (Hajjar et al., 2003; Marques et al., 2006). The availability of IGFs was also modulated by the appliance, since the distribution of several IGF-binding proteins was altered (Hajjar et al., 2006).
Mechanical forces are important for the maintenance of the articular cartilage. Strenuous loading usually inhibits cell metabolism (Smith et al., 2004), while optimal loading at an appropriate frequency raises an anabolic response in chondrocytes (Tang et al., 2004). A recent study demonstrated that restricted mandibular movements reduce endochondral bone formation in the developing condylar cartilage (Habib et al., 2005). Similarly, decreased loading, promoted by cutting incisive teeth and/or a soft diet, decreased cell proliferation, extracellular matrix production (Pirttiniemi et al., 2004), and bone formation (Sasaguri et al., 1998).
Mechanical forces exerted on the cartilage may be transmitted to cells through integrins, which are heterodimeric transmembrane receptors formed by and βsubunits. Signaling elicited by integrins regulates gene expression, cytoskeletal arrangement, and other chondrocyte functions (Loeser, 2000; Millward-Sadler and Salter, 2004).
The classic receptor for fibronectin, integrin 5β1, as well as other fibronectin receptors containing the v subunit, seem to be very important for the transmission of forces from extracellular matrix to cells (Woods et al., 1994; Wright et al., 1997). Fibronectin plays important roles in the regulation of chondrocyte metabolism and matrix maintenance and repair (Martin and Buckwalter, 1998). The synthesis and aggregation of fibronectin itself can be modulated by biochemical or mechanical stimuli (Burton-Wurster et al., 1997; Mao and Schwarzbauer, 2005).
Considering the important role of mechanical stimuli on cartilage metabolism, we hypothesized that the force generated by a mandibular propulsor appliance is transmitted to chondrocytes via integrins, which transduce this signal into a biological response, such as gene expression regulation and growth.
|
MATERIALS & METHODS
|
|---|
Orthopedic Appliance
The appliance was described by Hajjar et al.(2003). It consisted of an inclined plane that promoted the anterior displacement of the mandible every time the animals attempted to close their mouths. The animals used the appliance daily, from 8:00 a.m. to 6:00 p.m. A soft leather collar prevented the appliance’s removal.
Animals and Tissue Processing
All procedures were performed in accordance with NIH guidelines and were approved by the Ethical Committee on Animal Research of the Institute of Biomedical Sciences/USP. For immunohistochemical studies, 56 28-day-old male Wistar rats were divided into 14 groups (with 4 rats each): those treated with the appliance for 3, 5, 7, 9, 11, 15, and 30 days and their age-matched controls, which used the collar only. Water was available at all times, and food was available only at night. Following the treatment period, the rats were anesthetized and perfused with 0.9% saline, followed by 4% formaldehyde solution. After 24-hour post-fixation in 4% formaldehyde solution, the condyles were decalcified in 4.13% EDTA for 30 days. Sagittal 5-µm-thick sections were placed on Poly-L-Lysine-coated slides. For real-time PCR analysis, 24 rats were divided into 4 groups: those treated with the appliance for 15 and 30 days and their age-matched controls. The condylar cartilage was dissected, immediately frozen in liquid nitrogen, and stored at –80° C.
Immunohistochemistry
Incubation with primary antibodies (1:100 dilution in PBS/0.5% BSA) anti-fibronectin (AB2040, Chemicon Int. Inc., Temecula, CA, USA), anti-5 (AB1928 Chemicon), and anti-v (AB1930 Chemicon) integrin subunits was performed in a humidified chamber, overnight at room temperature. The incubation with the biotin-labeled secondary antibodies (Jackson Immunoresearch Labs, West Grove, PA, USA), diluted 1:300, was performed under the same conditions for 2 hrs, followed by 2 hours’ incubation with the avidin-biotin-peroxidase complex (kit ABC-Elite®, Vector, Burlingame, CA, USA). Staining was developed with 3,3'diamino-benzidine (DAB) and 0.02% H2O2. For Proliferating Cell Nuclear Antigen (PCNA) localization, endogenous alkaline phosphatase activity was blocked with 15% acetic acid solution for 8 min. The PC-10 primary antibody (DAKO, Copenhagen, Denmark) was diluted 1:250, and the incubation was performed overnight at room temperature. The biotin-labeled secondary antibody was diluted 1:500. The slides were incubated with streptavidin conjugated with alkaline phosphatase (1:500) for 2 hrs at RT, and the immunoreactivity was revealed by 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT, Sigma Chemicals, St. Louis, MO, USA). Negative controls lacked the primary antibody.
Quantitative and Semi-quantitative Analyses
The condylar cartilage was divided into anterior, central, and posterior regions, which were analyzed separately. For quantification of PCNA-labeled cells, 300 cells were counted at 100x magnification, and the results were expressed as the percentage of labeled cells. Four animals were used in each group. For the semi-quantitative analysis of integrins, performed only in the proliferative cell layer (where all cells were labeled), labeling intensity was qualified as absent (arbitrary value = 0), weak (arbitrary value = 1), medium (arbitrary value = 2), or strong (arbitrary value = 3). Data obtained from different groups were plotted to show variations in integrin expression during development and treatment.
Cell Culture and Mechanical Stimulus
Cells were obtained from the condylar cartilage of newborn rats by sequential enzymatic digestion with hyaluronidase (1.66 mg/mL), trypsin (2 mg/mL), and collagenase (2 mg/mL). Approximately 1 x 105 cells were seeded on collagen-I-coated distensible-bottomed BioFlex six-well plates (Flexcell International, Hillsborough, NC, USA) and grown for 10–12 days. BioFlex plates were then positioned in a Flexcell Strain Unit (Flexcell International) and subjected to 7% elongation, at a frequency of 0.33 Hz for 4 hrs. Control plates were kept under similar conditions without being stretched. In some samples, GRGDSP (RGD) and GRGESP (RGE) peptides were added to the medium 30 min before the stretching.
Real-time PCR
We used the Gene Amp® 5700 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). We used Primer Express Software (Applied Biosystems) to design the following primers: Fibronectin (F - GCAGAGCTTGATCCTGTCTACATC, R - ACTGTGGACCAGGTTGATGACA NM019143), IGF-I (F -GGGCATTGTGGATGAGTGTTG , R - TTGCAGCGGACACAG TACATCT M11188), IGF-II (F - GAAGCAGCACTCTTCCACG AT, R - TTCTACTTCAGCAGG CCTTCAAGNM1 78866.2), and PCNA (F - GAGCTTGGCAATGGGAACAT, R - CTCATTCA TCTCTATGGACACAGCTT NM031511.1). The housekeeping gene 18S (GeneBank NM11188; Schmittgen and Zakrajsek, 2000) or GAPDH was used for normalization. Primers were obtained from Invitrogen (Carlsbad, CA, USA) and Prodimol Biotecnologia S.A (Belo Horizonte, MG, Brazil). Reverse transcription and Real-time polymerase chain-reaction were performed as previously described (Aoki et al., 2006).
Statistical Analysis
For comparisons between groups, analysis of variance (one-way ANOVA) was applied, followed by Tukey’s test, with significance levels at p < 0.05.
|
RESULTS
|
|---|
Fibronectin Protein and mRNA Expression
After 15 days’ use of the appliance, fibronectin mRNA was increased in the cartilage by six-fold (p < 0.01), returning to control levels after 30 days (Fig. 1A ). There was no variation in fibronectin mRNA expression in control animals.
View larger version (145K):
[in this window]
[in a new window]
|
Figure 1. The propulsive appliance increased fibronectin expression and distribution in the condylar cartilage. (A) Fibronectin mRNA expression in the condylar cartilage of rats treated for 15 or 30 days and their age-matched controls. Results are presented as mean ± standard deviation of mRNA levels, expressed as fold-induction over the respective controls. Results were analyzed by ANOVA and Tukey’s post-test. *p < 0.01 (n = 6). (B) Immunohistochemical staining of fibronectin in the cartilage, showing the fibrous (f), proliferative (p), chondroblast (c), and hypertrophic (h) layers. (a-c) Control groups C5, C15, and C30, respectively. (d-f) Treated groups T5, T15, and T30, respectively. (g) Negative control, consisting of the omission of the primary antibody. Bar = 100 µm.
|
|
In control rats, fibronectin protein distribution was observed in all cartilage layers from the age of 34 days on. Labeling was both intracellular and extracellular, increasing over time in the proliferative compartment up to 57 days of age (Fig. 1B ). The appliance increased fibronectin staining in the proliferative compartment from basal levels to a maximum effect after 15 days of treatment, which decreased after 30 days (Fig. 1B).
Distribution of 5- and v-containing Integrins
To illustrate cyclical variations in integrin distribution in the proliferative compartment and the effects of the appliance on this parameter, we performed a semi-quantitative analysis based on the immunoreactivity of integrins (Fig. 2). In the control group, integrin subunits v and 5 were observed in all cartilage layers between 30 and 57 days of age, and the labeling intensity varied only in the proliferative compartment. This variation followed a cyclical pattern and was best observed in shorter intervals of treatment (from 3 to 11 days). The v staining was stronger at the ages of 34, 38, and 57 days, whereas the 5 staining was stronger in 30- and 34-day-old rats. The appliance modulated both integrins similarly, abolishing variations from 30 to 36 days of age (3 and 9 days of treatment) and maintaining a higher expression when compared with control rats (Fig. 2).
Cellular Proliferation
We used PCNA staining to estimate the numbers of proliferative cells in the anterior, central, and posterior regions of the condylar cartilage. When the whole condyle was considered, the appliance increased PCNA labeling in almost all groups (Fig. 3A). The anterior and posterior cartilage regions were the most responsive to the stimulus (Figs. 3B, 3C, 3D, and 3E). The appliance significantly increased cell proliferation after 3, 5, 7, 11, and 30 days of treatment in the anterior region (Fig. 3C), after 3 and 11 days in the central region (Fig. 3D), and after 3, 5, 7, 9, 11, and 15 days in the posterior region (Fig. 3E).
View larger version (145K):
[in this window]
[in a new window]
|
Figure 3. The propulsive appliance stimulated cell proliferation in the rat condylar cartilage. The number of proliferating cells was estimated based on immunoreactivity for PCNA. Results were expressed as % of labeled cells in the whole cartilage (A), or separately in the anterior (C), central (D), and posterior (E) cartilage regions. *P < 0.05, according to ANOVA and Tukey’s post-test (n = 4). (B) shows a reaction for PCNA in the anterior (d), central (e), and posterior regions (f) of the cartilage from rats that wore the appliance for 15 days, compared with their age-matched controls (a-c). Cells positively labeled are shown in blue. Bar = 100 µm.
|
|
Effects of Mechanical Stretch on Cultured Chondrocytes
Cyclical distension of cartilage-derived cells increased fibronectin (12-fold, p < 0.001), IGF-I (two-fold, p < 0.01), IGF-II (three-fold, p < 0.01), and PCNA (two-fold, p < 0.05) mRNA expression compared with the non-stretched control group (Fig. 4). The RGD peptide blocked this effect on fibronectin, IGF-I, and PCNA expression, but did not affect IGF-II mRNA. The RGE control peptide had no effect, showing results similar to those observed for the stretched cells.
View larger version (25K):
[in this window]
[in a new window]
|
Figure 4. Cyclic mechanical stretch regulated mRNA expression in cartilage-derived cells through RGD-binding integrins. Gene expression analyses of fibronectin (A), PCNA (B), IGF-I (C), and IGF-II (D) are shown in the non-stretched group (NS); the stretched group (S); the group stretched and treated with peptide containing RGE sequence (S+RGE); and the group stretched and treated with peptide containing RGD sequence (S+RGD). Data were normalized relative to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and presented as Mean ± Standard Deviation of fold-induction (n = 3  5). Control is arbitrarily set as 1. #p < 0.05 vs. NS; *p < 0.05 vs. S; +p < 0.05 vs. S+RGE (one-way ANOVA followed by Tukey’s procedure for multiple comparisons).
|
|
|
DISCUSSION
|
|---|
The results showed that integrins containing the 5 and v subunits were homogeneously distributed in the condylar cartilage during growth, varying in expression only in the proliferative compartment. The use of the appliance markedly reduced such variation and maintained integrin expression higher than in control groups. Fibronectin protein and mRNA expression were also up-regulated by treatment, as was cell proliferation. In vitro assays showed that force itself stimulated cell proliferation and the expression of fibronectin and IGFs. The results also showed that, except for IGF-II expression, all effects were mediated by RGD-binding integrins.
Besides hormonal regulation, condylar cartilage metabolism is modulated by occlusal forces from mastication (Hinton, 1988), and it has been well-established that a suitable mechanical load is necessary for the homeostasis of this cartilage (Bouvier, 1987). The synthesis of fibronectin and other matrix proteins, for example, can be modulated by cyclic compression (Wong et al., 1999) or stretching forces (Onodera et al., 2005). In contrast, increases in the magnitude and/or duration of the load can also inhibit fibronectin synthesis (Steinmeyer and Ackermann, 1999), showing that the response to applied forces depends on the frequency and the total load applied (Ching et al., 2003).
In this study, the intermittent stimulus promoted by the appliance increased fibronectin mRNA expression by six-fold after 15 days, returning to control levels after 30 days. Our results corroborate the work of Steinmeyer et al.(1997), showing that intermittent stimuli increased fibronectin synthesis; intermittence seemed to be more important than the duration of the stimulus.
Fibronectin binds different integrins on the cell surface. The 5 subunit forms the fibronectin receptor 5β1, while the v subunit combines with different β subunits to form a variety of fibronectin/vitronectin receptors (Woods et al., 1994). During growth, a variable distribution of 5 and v integrins was observed in the condylar proliferative compartment. Curiously, such variation was not observed in the knee articular cartilage of growing dogs (Stahlmann et al. 2000). An increase in the amount of 5 after mechanical deformation or continuous cyclic compressive stress has been previously demonstrated in chondrocytes (Lucchinetti et al., 2004). Likewise, traction of the midpalatal suture cartilage with the use of an orthopedic appliance increased the number of cells expressing 5 (Takahashi et al., 2003).
The number of PCNA-labeled proliferating cells in the cartilage of control rats varied with growth, being lower at the ages of 32 and 36 days and higher in 42-day-old rats. This observation might be related to the fact that, in the rat, growth proceeds irregularly, consisting of multiple incremental bursts (Hermanussen et al., 1998). Treatment increased cell proliferation, especially in the anterior and posterior cartilage extremities, where traction forces promoted by the appliance are expected to be higher. We have previously postulated that this effect might be partially attributed to an increase in the local expression of IGF-I and IGF-II (Hajjar et al., 2003). Interestingly, treatment with growth hormone, which stimulates the synthesis of IGF-I by the liver, increases condylar cartilage growth both in vitro and in vivo (Blumenfeld et al., 2000; Ramirez-Yanez et al., 2004). Although condylar cartilage growth probably results in bone formation, it would be interesting to perform long-term studies to determine the actual mandibular growth in control and treated groups, perhaps with biochemical markers such as collagen X (Shen et al., 2005) or accurate bone measurements.
One very intriguing possibility is a relationship between the increased expression of fibronectin and fibronectin-binding integrins in the proliferative compartment and cell proliferation. The increase in 5 and fibronectin might be associated with a less differentiated and more proliferative phenotype, as shown by Goessler and co-workers (2005). It has been reported that fibronectin, alone or associated with collagens, promotes extracellular matrix synthesis and proliferation of cultured chondrocytes (Ramdi et al., 1993). A recent study also showed that fibronectin rescues chondrocytes from the inhibitory effect of Fibroblast Growth Factor on cell proliferation, activating specific signaling pathways (Jang and Chung, 2005).
The up-regulation of IGFs and PCNA mRNA by the mechanical stimulus corroborated our present and previous data (Hajjar et al., 2003). Additionally, we showed that this regulation is dependent on RGD-binding integrins, except for IGF-II, which appears to be regulated by a different pathway. It is known that integrin and IGF signaling pathways may interact in some systems. In human cartilage, the blocking of 5 abolished the survival effect of IGF-I or fibronectin (Pulai et al., 2002).
This study contributed to the elucidation of some molecular mechanisms involved in orthopedic functional therapy, widely used in dentistry but still poorly understood.
|
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Alexandre Kihara and Emilia Ribeiro for the support. This investigation was supported by FAPESP (01/09047-2 and 06/57508-2). M.R. Marques received a FAPESP scholarship.
Received for publication May 9, 2007.
Revision received August 31, 2007.
Accepted for publication September 20, 2007.
|
REFERENCES
|
|---|
- Aoki MS, Miyabara EH, Soares AG, Saito ET, Moriscot AS (2006). mTOR pathway inhibition attenuates skeletal muscle growth induced by stretching. Cell Tissue Res 324:149–156.[Medline]
[Order article via Infotrieve]
- Blumenfeld I, Gaspar R, Laufer D, Livne E (2000). Enhancement of toluidine blue staining by transforming growth factor-beta, insulin-like growth factor and growth hormone in the temporomandibular joint of aged mice. Cells Tissues Organs 167:121–129.[Medline]
[Order article via Infotrieve]
- Bouvier M (1987). Variation in alkaline-phosphatase activity with changing load on the mandibular condylar cartilage in the rat. Arch Oral Biol 32:671–675.[CrossRef][Medline]
[Order article via Infotrieve]
- Burton-Wurster N, Lust G, Macleod JN (1997). Cartilage fibronectin isoforms: in search of functions for a special population of matrix glycoproteins. Matrix Biol 15:441–454.[CrossRef][Medline]
[Order article via Infotrieve]
- Ching CT, Chow DH, Yao FY, Holmes AD (2003). The effect of cyclic compression on the mechanical properties of the inter-vertebral disc: an in vivo study in a rat tail model. Clin Biomech (Bristol, Avon) 18:182–189.[CrossRef]
- Goessler UR, Bugert P, Bieback K, Huber K, Fleischer LI, Hormann K, et al. (2005). Differential modulation of integrin expression in chondrocytes during expansion for tissue engineering. In Vivo 19:501–507.[Abstract/Free Full Text]
- Habib H, Hatta T, Udagawa J, Zhang L, Yoshimura Y, Otani H (2005). Fetal jaw movement affects condylar cartilage development. J Dent Res 84:474–479.
- Hajjar D, Santos MF, Kimura ET (2003). Propulsive appliance stimulates the synthesis of insulin-like growth factors I and II in the mandibular condylar cartilage of young rats. Arch Oral Biol 48:635–642.[Medline]
[Order article via Infotrieve]
- Hajjar D, Santos MF, Kimura ET (2006). Mandibular repositioning modulates IGFBP-3, -4, -5 and -6 expression in the mandibular condylar cartilage of young rats. Biorheology 43:311–321.[Medline]
[Order article via Infotrieve]
- Hermanussen M, Rol de Lama MA, F-Tresguerres JA, Grasedyck L, Burmeister J (1998). Short-term growth: evidence for chaotic series of mini growth spurts in rat growth. Physiol Behav 64:7–13.[Medline]
[Order article via Infotrieve]
- Hinton RJ (1988). Effect of altered masticatory function on [3H]-thymidine and [35S]-sulfate incorporation in the condylar cartilage of the rat. Acta Anat (Basel) 131:136–139.[Medline]
[Order article via Infotrieve]
- Jang JH, Chung CP (2005). Fibronectin-mediated adhesion rescues cell cycle arrest induced by fibroblast growth factor-1 by decreased expression of p21(cip/waf) in human chondrocytes. In vitro Cell Dev Biol Anim 41:126–129.[Medline]
[Order article via Infotrieve]
- Loeser RF (2000). Chondrocyte integrin expression and function. Biorheology 37:109–116.[Medline]
[Order article via Infotrieve]
- Lucchinetti E, Bhargava MM, Torzilli PA (2004). The effect of mechanical load on integrin subunits alpha5 and beta1 in chondrocytes from mature and immature cartilage explants. Cell Tissue Res 315:385–391.[CrossRef][Medline]
[Order article via Infotrieve]
- Mao Y, Schwarzbauer JE (2005). Fibronectin fibrillogenesis, a cell-mediated matrix assembly process. Matrix Biol 24:389–399.[CrossRef][Medline]
[Order article via Infotrieve]
- Marques MR, Hajjar D, Crema VO, Kimura ET, Santos MF (2006). A mandibular propulsive appliance modulates collagen-binding integrins distribution in the young rat condylar cartilage. Biorheology 43:293–302.[Medline]
[Order article via Infotrieve]
- Martin JA, Buckwalter JA (1998). Effects of fibronectin on articular cartilage chondrocyte proteoglycan synthesis and response to insulin-like growth factor-I. J Orthop Res 6:752–757.
- Millward-Sadler SJ, Salter DM (2004). Integrin-dependent signal cascades in chondrocyte mechanotransduction. Ann Biomed Eng 32:435–446.[CrossRef][Medline]
[Order article via Infotrieve]
- Onodera K, Takahashi I, Sasano Y, Bae JW, Mitani H, Kagayama M, et al. (2005). Stepwise mechanical stretching inhibits chondrogenesis through cell-matrix adhesion mediated by integrins in embryonic rat limb-bud mesenchymal cells. Eur J Cell Biol 84:45–58.[Medline]
[Order article via Infotrieve]
- Pirttiniemi P, Kantomaa T, Sorsa T (2004). Effect of decreased loading on the metabolic activity of the mandibular condylar cartilage in the rat. Eur J Orthod 26:1–5.[Abstract/Free Full Text]
- Pulai JI, Del Carlo M Jr, Loeser RF (2002). The alpha5beta1 integrin provides matrix survival signals for normal and osteoarthritic human articular chondrocytes in vitro. Arthritis Rheum 46:1528–1535.[CrossRef][Medline]
[Order article via Infotrieve]
- Ramdi H, Legay C, Lievremont M (1993). Influence of matricial molecules on growth and differentiation of entrapped chondrocytes. Exp Cell Res 207:449–454.[Medline]
[Order article via Infotrieve]
- Ramirez-Yanez GO, Young WG, Daley TJ, Waters MJ (2004). Influence of growth hormone on the mandibular condylar cartilage of rats. Arch Oral Biol 49:585–590.[CrossRef][Medline]
[Order article via Infotrieve]
- Sasaguri K, Jiang H, Chen J (1998). The effect of altered functional forces on the expression of bone-matrix proteins in developing mouse mandibular condyle. Arch Oral Biol 43:83–92.[CrossRef][Medline]
[Order article via Infotrieve]
- Schmittgen TD, Zakrajsek BA (2000). Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods 46:69–81.[CrossRef][Medline]
[Order article via Infotrieve]
- Shen G, Hagg U, Rabie AB, Kaluarachchi K (2005). Identification of temporal pattern of mandibular condylar growth: a molecular and biochemical experiment. Orthod Craniofac Res 8:114–122.[Medline]
[Order article via Infotrieve]
- Smith RL, Carter DR, Schurman DJ (2004). Pressure and shear differentially alter human articular chondrocyte metabolism: a review. Clin Orthop Relat Res 427(Suppl):S89–S95.[Medline]
[Order article via Infotrieve]
- Stahlmann R, Kühner S, Shakibaei M, Flores J, Vormann J, van Sickle DC (2000). Effects of magnesium deficiency on joint cartilage in immature beagle dogs: immunohistochemistry, electron microscopy, and mineral concentrations. Arch Toxicol 73:573–580.[Medline]
[Order article via Infotrieve]
- Steinmeyer J, Ackermann B (1999). The effect of continuously applied cyclic mechanical loading on the fibronectin metabolism of articular cartilage explants. Res Exp Méd (Berl) 198:247–260.[Medline]
[Order article via Infotrieve]
- Steinmeyer J, Ackermann B, Raiss RX (1997). Intermittent cyclic loading of cartilage explants modulates fibronectin metabolism. Osteoarthritis Cartilage 5:331–341.[CrossRef][Medline]
[Order article via Infotrieve]
- Takahashi I, Onodera K, Sasano Y, Mizoguchi I, Bae JW, Mitani H, et al. (2003). Effect of stretching on gene expression of beta1 integrin and focal adhesion kinase and on chondrogenesis through cell-extracellular matrix interactions. Eur J Cell Biol 82:182–192.[CrossRef][Medline]
[Order article via Infotrieve]
- Tang GH, Rabie AB, Hagg U (2004). Indian hedgehog: a mechanotransduction mediator in condylar cartilage. J Dent Res 83:434–438.
- Wong M, Siegrist M, Cao X (1999). Cyclic compression of articular cartilage explants is associated with progressive consolidation and altered expression pattern of extracellular matrix proteins. Matrix Biol 18:391–399.[CrossRef][Medline]
[Order article via Infotrieve]
- Woods VL Jr, Schreck PJ, Gesink DS, Pacheco HO, Amiel D, Akeson WH, et al. (1994). Integrin expression by human articular chondrocytes. Arthritis Rheum 37:537–544.[Medline]
[Order article via Infotrieve]
- Wright MO, Nishida K, Bavington C, Godolphin JL, Dunne E, Walmsley S, et al. (1997). Hyperpolarisation of cultured human chondrocytes following cyclical pressure-induced strain: evidence of a role for alpha 5 beta 1 integrin as a chondrocyte mechanoreceptor. J Orthop Res 15:742–747.[CrossRef][Medline]
[Order article via Infotrieve]
Journal of Dental Research, Vol. 87, No. 2,
153-158 (2008)
DOI: 10.1177/154405910808700210
 CiteULike  Complore  Connotea  Del.icio.us  Digg  Reddit  Technorati  Twitter What's this?
|
|
TOP
ABSTRACT
INTRODUCTION