Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Carrouel, F.
Right arrow Articles by Bleicher, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrouel, F.
Right arrow Articles by Bleicher, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

HUGO (FNDC3A): a New Gene Overexpressed in Human Odontoblasts

F. Carrouel1,2,3,4,5,6, M.-L. Couble1,2,3,4,5,6, C. Vanbelle1,7, M.-J. Staquet1,2,3,4,5,6, H. Magloire1,2,3,4,5,6 and F. Bleicher1,2,3,4,5,6,*

1 Université de Lyon, Villeurbanne, F-69000, France;
2 Université Lyon 1, Faculté d’Odontologie, Lyon, F-69008, France;
3 CNRS, UMR 5242, IGFL, Lyon, F-69007, France;
4 INRA, UMR 1288, Lyon, F-69007, France;
5 ENSL, Lyon, F-69007, France;
6 INSERM, ERI 16, Lyon, F-69008, France; and
7 Université Lyon 1, CeCIL, IFR62, Lyon, F-69008, France

Correspondence: * corresponding author, IGFL/INSERM ERI 16, Faculté d’Odontologie, Rue Guillaume Paradin, 69372 LYON Cedex 08, France, bleicher{at}univ-lyon1.fr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previously, we established a subtractive cDNA library enriched in odontoblast-specific genes and hypothesized that new, previously unidentified, markers would be present, associated with the odontoblast phenotype. In this paper, we report the first characterization of a new gene we have named HUGO, and its associated deduced protein sequence. This gene expression is under the control of two alternative promoters, resulting in the synthesis of two proteins, one of which, HUGO2, is included in the other, HUGO1. HUGO proteins are mainly composed of a proline-rich region at the N-terminus, 8 type III-fibronectin modules, and a transmembranous helix at the C-terminus. In odontoblasts, the proteins are located in Golgi vesicles. However, they display a broader expression pattern, since they are also expressed by nerve fibers in the dental pulp and other tissues (e.g., trachea, brain, kidney), as demonstrated by immunohistochemistry and qPCR, respectively. Their location in odontoblasts suggests a role in collagen and glycosaminoglycan synthesis.

Key Words: tooth • human odontoblast • new gene • type III-Fibronectin module • HUGO


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Odontoblasts are post-mitotic, neural-crest-derived cells, which differentiate according to tooth-specific temporospatial patterns. They are organized as a layer of palisaded cells along the interface between the dental pulp (soft connective tissue) and dentin. Their terminal differentiation is characterized by several steps, implying withdrawal from the cell cycle, elongation, and cytological polarization (Ruch et al., 1995). These cells play a central role during the formation of dentin, in that they synthesize and secrete the organic matrix macromolecules (pre-dentin) and actively participate in the transportation and accumulation of calcium at the mineralization front (Linde and Lundgren, 1995; Ruch et al., 1995). They are also known to participate in dentin regeneration following caries (Goldberg and Smith, 2004).

However, if dentin production is the main function of odontoblasts, it is not the only one. These cells are also thought to play a role in the protection of the dental pulp tissue. Indeed, odontoblasts are the first line of defense against cariogenic bacteria by initiating the innate immune response (Durand et al., 2006), and are suspected to play a role in tooth pain transmission by operating as sensors cells (Allard et al., 2006).

However, while the phenotype of dental pulp mesenchymal cells, during tooth initiation and morphogenesis stages, has been extensively documented (Jernvall and Thesleff, 2000), little is known about odontoblast cytodifferentiation and the resultant phenotype. This lack of information is due to the difficulty in micro-dissection and isolation of a pure odontoblast population, but the development of cultures of pulp cells differentiating into odontoblasts has reduced this barrier (Kuo et al., 1992; Stanislawski et al., 1997; Mesgouez et al., 2006). Previously, we established a human pulp explant culture system supportive of odontoblast differentiation at both morphological and functional levels (Couble et al., 2000). A cDNA library was then established by the application of suppression-subtractive hybridization to characterize odontoblast-specific genes (Buchaille et al., 2000a). Several differentially expressed cDNA clones were isolated, including extracellular matrix proteins, mitochondrial proteins, transcription factors, and unknown genes. A reverse Northern dot blot procedure applied to these unknown genes revealed the overexpression of a clone (clone D6 in Buchaille et al., 2000a) in odontoblast-like cells compared with pulpal precursor cells. In this study, we report the identification and initial characterization of this gene, which we have named HUGO (human gene expressed in odontoblasts). The aim of this study was to identify a new marker associated with the odontoblast phenotype.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture
Dental pulps were collected with informed consent from individuals in accordance with French legal requirements (article 672-1, Public Health Code). Human precursor pulp cells and odontoblast-like cells were obtained as previously described (Couble et al., 2000). COS-1 cells were cultured in DMEM medium (Invitrogen, Cergy-Pontoise, France) supplemented with 10% fetal calf serum (Eurobio, Les Ulis, France), 100 UI/mL penicillin-50 mg/mL streptomycin, and fungizone (Invitrogen). HUGO2 cDNA sequence was cloned in frame with the V5 tag in pcDNA 3.1, and transfected into COS-1 cells with the use of LipofectAmine 2000 (Invitrogen), according to the manufacturer’s instructions. Geneticin 1.2 3g/mL was added for the selection of these transfected cells.

RNA Extraction and cDNA Synthesis
Total RNA from odontoblast-like cells and precursor pulp cells was isolated by means of the Nucleospin RNA II kit (Macherey-Nagel, Düren, Germany). Total RNA from various human tissues was purchased from Clontech (Mountain View, CA, USA). RNA (1 µg) was converted into cDNA by AMV reverse transcriptase (Invitrogen).

5'-Rapid Amplification of cDNA Ends (5'-RACE)
The 5'-RACE Ready cDNA was generated with use of the SMART RACE cDNA Amplification Kit (Clontech). The Gene Specific Primer 1 was 5'-TGTGTTGTCATGTCTCCAGCTCCA-3'. The PCR product was purified and sequenced.

Northern Blot Analysis
Approximately 20 3g total odontoblast-like cells RNA per lane were separated by denaturing agarose gel electrophoresis and hybridized with a HUGO cDNA probe (nucleotides 162 to 550 in AJ749707) obtained by asymmetric PCR with 32P-dCTP, as described previously (Bleicher et al., 1999).

Real-time PCR
Real-time PCR was performed in a Light Cycler instrument (Roche, Meylan, France) with the Fast Start DNA Master SYBR Green I kit. Primer sets and annealing temperatures were: HUGO (forward, A T G C C C C A C A G G T T A T T GAAGACA; reverse, TTTCTG GGGTGATGATGGTGGACT; annealing temperature, 66° C), HUGO1 (forward, TCCCTCG GGTGAAACAGAAA; reverse, CGCTGACTGTTGGGGTTGTT; annealing temperature, 70° C), HUGO2 (forward, AGCCGTTC TCCAATTAAAGC; reverse, GC A G G A C C A C T C A T T T C G T T ; annealing temperature, 58° C), and cyclophilin A (forward, ATGG CACTGGTGGCAAGTCC; reverse, TTGCCATTCCTGGA CCCAAA; annealing temperature, 58° C).

In situ Hybridization
Probe labeling and in situ hybridization were performed as previously described (Bleicher et al., 1999; Buchaille et al., 2000b).

Antiserum Preparation
We raised the antiserum by immunizing a rabbit against two synthetic peptides (RDERSSKTYER; SQRTEPPASTNRDT). The peptide synthesis and the immunization procedure were performed by CovalAb (Lyon, France). For antiserum purification, the peptides were coupled to Sepharose gel, and the antibodies were affinity-purified by standard methods.

Western Blotting
Total proteins were extracted with RIPA buffer. Western blotting was performed according to a standard protocol (BioRad Laboratories, Hercules, CA, USA). Immunoreactivity was visualized by means of a chemiluminescence ECL system (GE Healthcare, Saclay, France).

Flow Cytometry
Cells were obtained following trypsin/EDTA treatment of cultures and incubated for 30 min with anti-HUGO (purified IgG) or normal rabbit IgG. Staining was revealed by goat anti-rabbit IgG-FITC (Invitrogen). For intracytoplasmic detection, cells were stained in Fix&Perm reagent (Invitrogen) according to the manufacturer’s instructions. Data were acquired on a DAKO cytometer (DAKO, Glostrup, Denmark) and analyzed with WinMDI 2.8 software (Scripps Institute, La Jolla, CA, USA).

Immunochemistry
Cryostat sections and odontoblast-like cell cultures were prepared as described previously (Magloire et al., 2003; Allard et al., 2006). They were reacted for double immunostaining with HUGO antibody, Golgizone antibody (Chemicon, Temecula, CA, USA), and β2 tubulin antibody (kind gift of Pr. Dumontet, Lyon, France). After being rinsed, they were reacted with Alexa fluor 488 goat anti-rabbit IgG and Alexa fluor 594 goat anti-mouse IgG (Invitrogen) and observed by epifluorescence (Olympus BX50, Rungis, France) and confocal (Zeiss LSM510, Zeiss, Le Pecq, France) microscopy. Negative controls were achieved by omitting the primary antibody, by incubating with normal rabbit or mouse IgG, and with pre-absorbed antibody.

Electron Microscopy Peroxidase Immunolabeling
HUGO detection was performed according to a process described previously (Veron et al., 1990, 1993). Ultrathin sections were observed under a JEOL 1200 electron microscope without contrast (JEOL, Tokyo, Japan).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterization of HUGO at the Gene and Protein Levels
We applied a 5'-RACE PCR strategy to isolate the complete HUGO cDNA from odontoblast-like cells, which resulted in the isolation of a cDNA fragment of about 4600 bp. Sequencing of this band revealed the presence of two cDNAs showing a difference in their 5' UTR. Their sequences were deposited in the GenBank database under references AJ749706 (HUGO1) and AJ749707 (HUGO2). A Northern blot analysis on mRNA extracted from odontoblast-like cells confirmed the expression of the gene in these cells as two transcripts of 8500 and 6500 nucleotides, respectively (Fig. 1AGo). According to genome resources (www.ensembl.org), these genes are located on chromosome 13q14.2 and have a genomic organization consisting of 26 exons and 25 introns for HUGO1 and 24 exons and 23 introns for HUGO2 (Fig. 1BGo). Moreover, cDNA sequence alignment on chromosome 13 indicates that HUGO1 and HUGO2 have the last 23 exons in common, but differ at their 5' end, using different sets of exons (Fig. 1BGo). The open reading frame of HUGO1 cDNA is 3594 nucleotides long, coding for a 1198-amino-acid protein with a predicted pI of 6.68 and a molecular mass of 131.8 kDa, whereas the open reading frame of HUGO2 is 3402 nucleotides long, encoding a 1134-amino-acid protein with a pI of 7.07 and a molecular mass of 125 kDa. Alignment between the deduced protein sequences (Corpet, 1988) showed that the HUGO2 protein sequence is contained in the HUGO1 sequence (Fig. 1CGo). Protein sequence analysis demonstrated that the two HUGO isoforms are mainly composed of 8 type III-fibronectin modules. A proline-rich region is present at the N-terminus and a transmembranous helix at the C-terminus of the proteins (Fig. 1CGo). Evolutionary analysis of the protein showed that HUGO is highly conserved, since human and rat sequences shared 84% homology of identity and human and Tetraodon sequences shared 56% homology of identity (data not shown). The evolutionary tree also demonstrates the existence of a related protein family, named FNDC3B (cf. APPENDIX).


Figure 1
View larger version (48K):
[in this window]
[in a new window]

 
Figure 1. Characterization of HUGO gene and protein sequences. (A) Northern blot analysis of HUGO expression reveals the presence of two transcripts in odontoblast-like cells. (B) Schematic representation of exon-intron structures of HUGO1 and HUGO2 isoforms. HUGO1 is composed of 26 exons and 25 introns, and HUGO2 consists of 24 exons and 23 introns. The difference between HUGO1 and HUGO2 structures is observed at the 5' end. Exon 4 of HUGO1 corresponds to Exon 2 of HUGO2. (C) Amino acid sequence of HUGO. The entire sequence corresponds to HUGO1, whereas the sequence of HUGO2 is indicated in bold characters. Type III-fibronectin domains are boxed in grey. The underlined sequence corresponds to the proline-rich region. The framed sequence indicates the transmembrane domain. The two peptides used for rabbit immunization are double-framed.

 
Characterization of HUGO Gene Expression Pattern
Real-time PCR, realized with primers in the common sequence of both transcripts, showed that HUGO is 10-fold overexpressed in odontoblast-like cells compared with the pulpal precursor cells (Fig. 2AGo), and is also highly expressed in the trachea and, to a lesser extent, in the brain, kidney, lung, and liver (Fig. 2BGo). The same pattern of expression was obtained with specific primers for HUGO1 or HUGO2 transcripts (Figs. 2A, 2BGo). However, COS-1 cells express only HUGO2 transcripts (Fig. 2AGo). In situ hybridization on human dental pulp sections confirmed the expression of HUGO in the odontoblast layer (Fig. 2DGo), as well as in nerve fibers in the pulp (Fig. 2EGo).


Figure 2
View larger version (58K):
[in this window]
[in a new window]

 
Figure 2. HUGO gene expression pattern. Real-time PCR analysis of HUGO, HUGO1, and HUGO2 in precursor pulp cells, odontoblast-like cells, and COS-1 cells (A) and in different tissues (B). Expression of each target gene was normalized to the cyclophilin A housekeeping gene, with the use of RelQuant software (Roche). Results were expressed as fold-change values relative to precursor pulp cells. A significant increase of gene expression for HUGO (11-fold), HUGO1 (3.5-fold), and HUGO2 (nine-fold) can be observed in odontoblast-like cells compared with precursor pulp cells. In COS-1 cells, the HUGO2 transcript is expressed, whereas HUGO1 is not detected. The transcripts of HUGO, HUGO1, and HUGO2 can be detected mainly in the trachea and, to a lesser extent, in the brain, liver, kidney, and lung, but not in the heart (B). (C,D,E,F) In situ hybridization on a human dental pulp section. (C) Methylene blue counter-stained section shows the odontoblast cell bodies organized as a layer (double arrows) at the periphery of the pulp, and pulp cells (arrows) scattered in the underlying tissue. (D) With the antisense probe, the HUGO transcript is detected in the odontoblast layer. (E) The HUGO transcript is also expressed in nerve fibers. (F) Negative control with the sense probe. No significant signal is detected in the pulp and the odontoblast layer. DP, dental pulp; Od, odontoblasts; PPC, precursor pulp cells; NF, nerve fibers. Bars represent 50 µm.

 
Characterization of HUGO Protein Expression Pattern
A purified polyclonal antibody, raised against two human peptides of HUGO (Fig. 1CGo), was characterized by Western blot with proteins extracted from odontoblast-like cells, precursor pulp cells, and from COS-1 cells overexpressing V5-6xHis-tagged HUGO2 protein (Fig. 3AGo). The V5-6xHis-tag added 47 amino acids (5114 Da) to the HUGO2 C-terminal end. No band was detected by the V5-antibody on protein extracts from odontoblast-like cells, precursor pulp cells, and non-transfected COS-1 cells. One band of about 130 kDa appeared with this antibody on HUGO2-transfected COS-1 cells, corresponding to the tagged protein. The anti-HUGO antibody reacted with one band of 120 kDa in non-transfected COS-1 cells, corresponding to HUGO2. Two bands of about 130 kDa and 120 kDa (V5-6xHis-tagged HUGO2 and HUGO2, respectively) were detected in HUGO2-transfected COS-1 cells, whereas two bands of the same size were seen in odontoblast-like cells and precursor pulp cells (but corresponding to HUGO1 and HUGO2, respectively). Controls (see Fig. 3Go, legend) did not reveal any non-specific staining. Analysis of these data, together, indicates that the polyclonal antibody is specific to HUGO. Flow cytometry analysis indicates the cytoplasmic localization of the protein, since labeling of both precursor pulp cells and odontoblast-like cells was seen only when a permeabilization step was applied to the cells (Fig. 3BGo). Immunohistochemistry on human dental pulp sections showed a specific staining of the odontoblast layer (Fig. 3CGo) and nerve fibers (Fig. 3EGo). Double immunostaining for HUGO and β2 tubulin on nerve fibers demonstrated that both proteins did not co-localize (Fig. 4KGo). In odontoblast-like cells, a punctiform staining was seen in the Golgi zone around the nucleus (Figs. 3F, 3GGo). A double staining with an anti-Golgi zone antibody showed a co-localization between this marker and HUGO, both in vivo and in vitro (Fig. 4Go). Electron microscopy on these cells confirmed that the protein was localized in Golgi saccule-presenting aggregates (Fig. 3HGo).


Figure 3
View larger version (58K):
[in this window]
[in a new window]

 
Figure 3. Characterization of HUGO expression. (A) Western blot analysis of HUGO expression in precursor pulpal cells (1,5), odontoblast-like cells (2,6), COS-1 (3,7), and COS-1 overexpressing V5-6xHis-tagged HUGO protein (4,8). Antibodies (anti-HUGO and anti-V5) were used at 0.3 µg/mL and 0.06 µg/mL, respectively. Anti-V5 antibody (1–4) recognizes a 130-kDa protein only in COS-1 overexpressing V5-6xHis-tagged HUGO (4). Anti-HUGO antibody (5–8) recognizes HUGO1 and HUGO2 isoforms in precursor pulp cells (5) and odontoblast-like cells (6). Only the HUGO2 isoform is detected in COS-1 (7). The additional band of 130 kDa, recognized in COS-1 overexpressing V5-6xHis-tagged HUGO (8), is identical to that identified by the anti-V5 antibody (4). Controls were performed with anti-rabbit IgG (9), anti- mouse IgG2a (10), or the omission of primary antibody (11). (B) Flow cytometry analysis of HUGO expression. Cells were obtained following trypsin/EDTA treatment of cultures and directly labeled with anti-HUGO polyclonal antibody (filled histograms). HUGO was detected only in permeabilized cells, indicating a cytoplasmic localization. Controls with normal rabbit IgG are shown as empty histograms. Results are representative of three independent experiments. PPC: precursor pulpal cells. (C,D,E,F) Immunostaining of dental pulp and odontoblast-like cells. A positive labelling can be seen in odontoblasts with the anti-HUGO antibody (C), compared with the control section (D). In the pulp core, nerve bundles are also labeled (E). In odontoblast-like cells, HUGO is clearly identified around the nucleus (F). Bars represent 50 µm. (G,H) Electron micrograph of odontoblast-like cells showing indirect immunoperoxidase HUGO staining. Some Golgi vesicles were strongly labeled as dots of peroxidase deposits, particularly in close association with the vesicle membranes (arrows in H). In contrast, the rough endoplasmic reticulum was devoid of peroxidase deposits. N: nucleus. We created negative controls by omitting the primary antibody, by incubating cells with normal rabbit or mouse IgG and with pre-absorbed antibody (data not shown). Bars represent 1 µm. P, dental pulp; Od, odontoblasts; NF, nerve bundles; GV, Golgi vesicle; ER, endoplasmic reticulum; N, nucleus.

 

Figure 4
View larger version (77K):
[in this window]
[in a new window]

 
Figure 4. Co-localization of HUGO with Golgi vesicles. (A,B,C,D) Double staining shows a co-localization of the Golgi zone and HUGO within odontoblast-like cells (arrow). Note that only some specific vesicles (yellow) co-expressed both HUGO and the Golgi marker. The inset shows the same co-localization in the z axis. (D) Higher magnification of the Golgi region in (C) (arrow). (E,F,G,H) Co-localization of the Golgi zone and HUGO in odontoblasts in vivo. Yellow patches were strongly detected in some Golgi vesicles (arrow), well-identified in (H). The inset shows the double staining according to the z axis. (I,J,K) Double staining with β2 tubulin and HUGO reveals no co-localization between the two molecules, as demonstrated in (K) (inset). These confocal images were extracted from Z-series of optical sections. Negative controls were performed as described in Fig. 3Go.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this report, we describe the identification and initial characterization of a novel gene whose expression is highly up-regulated in odontoblast-like cells. We named it HUGO (HUman Gene expressed in Odontoblasts), but it is now referred to as FNDC3A in databases. Northern blot analysis and sequencing of the 5'RACE-PCR fragment demonstrated that this gene is expressed as two isoforms under the control of alternative promoters. The alternative usage of these promoters leads to the synthesis of two proteins, one of which (HUGO2) is included in the other (HUGO1). Many eukaryotic genes contain multiple promoters, each subjected to different regulatory factors controlling temporal or spatial expression. Alternative promoter usage often has physiological implications, as is the case for the acetylcholinesterase gene (Meshorer et al., 2004). Five alternative first exons have been described for this gene, one of which encodes an N-terminal extension of the protein, resulting in a transmembrane protein variant with distinct properties. The N-terminus specific sequence of HUGO1 does not seem to contain any characterized signature domain, and neither protein presents a signal peptide. However, only the HUGO2 promoter is active in COS-1 cells, as demonstrated by qPCR and Western blot, showing a cell-type-specific regulated expression. Both isoforms are mainly composed of 8 type III-fibronectin domains, which are widely spread among contemporary animal proteins, having thus far been identified in more than 50 different proteins (Pankov and Yamada, 2002). These include many extracellular proteins (for example, fibronectin itself), some intracellular proteins (titin, twitchin), and the extracellular domains of many kinds of membrane-receptor proteins. The main function of this module seems to be to mediate protein-protein or protein-glycosaminoglycan (GAG) interactions. Immunolocalization of HUGO in odontoblasts indicates that the protein is confined to Golgi vesicles, as demonstrated by confocal co-immunolocalization with a Golgi zone antibody and, more precisely, in Golgi vesicles corresponding to those showing parallel bands, as shown by electron microscopy. The labeling seems to be associated with the membranes of these vesicles, which can be explained by the presence of a transmembranous helix at the C-terminus of HUGO. These saccules have been described in native odontoblasts (Weinstock and Leblond, 1974) and are actively involved in the synthesis of pro-collagen molecules from the pro a-chains and their post-translational modifications, i.e., glycosylation and oxidative deamination of lysine residues. Moreover, these same saccules have been demonstrated to be involved in the secretion of GAGs (Takagi et al., 1981).

Analysis of these data led us to suggest that HUGO should be involved in the synthesis pathway of typeI collagen or GAG, which are the main molecules of the dentin matrix. The overexpression of HUGO in odontoblast-like cells, compared with the precursor pulp cells, supports this hypothesis. Indeed, odontoblast-like cells synthesize a larger amount of extracellular matrix than do precursor pulp cells in culture (Couble et al., 2000).

However, this gene is not specific for odontoblasts, since it is also expressed in nerves in the dental pulp and in different organs such as the trachea, and, to a lesser extent, in the kidney and brain. In dental nerve fibers, HUGO is most probably expressed in Schwann cells, since it does not co-localize with β2 tubulin, a marker of nerve fibers. Other preliminary immunochemical studies have demonstrated that only particular cell types are labeled in these tissues (data not shown). Further identification of these cells will allow us to identify the precise role of the HUGO protein. But whatever it may be, it seems to be essential for the cells, since its sequence is well-conserved throughout the phylogenic tree. The next steps will be to characterize the HUGO partner (GAG or protein) and make a conditional deletion of the gene in transgenic mice to elucidate the function of this protein.


    ACKNOWLEDGMENTS
 
This work was supported by IFRO, GIS "Maladies Rares", and the Rhône-Alpes region. We thank the CeCIL (Lyon) and the CTµ (Lyon) for providing technical facilities.


    FOOTNOTES
 
A supplemental appendix to this article is published electronically only at http://jdr.iadrjournals.org/cgi/content/full/87/2/131/DC1.

Received for publication July 6, 2007. Revision received November 21, 2007. Accepted for publication November 21, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Allard B, Magloire H, Couble ML, Maurin JC, Bleicher F (2006). Voltage-gated sodium channels confer excitability to human odontoblasts: possible role in tooth pain transmission. J Biol Chem 281:29002–29010.[Abstract/Free Full Text]
  • Bleicher F, Couble ML, Farges JC, Couble P, Magloire H (1999). Sequential expression of matrix protein genes in developing rat teeth. Matrix Biol 18:133–143.[CrossRef][Medline] [Order article via Infotrieve]
  • Buchaille R, Couble ML, Magloire H, Bleicher F (2000a). A subtractive PCR-based cDNA library from human odontoblast cells: identification of novel genes expressed in tooth forming cells. Matrix Biol 19:421–430.[CrossRef][Medline] [Order article via Infotrieve]
  • Buchaille R, Couble ML, Magloire H, Bleicher F (2000b). Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone 27:265–270.
  • Corpet F (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16:10881–10890.[Abstract/Free Full Text]
  • Couble ML, Farges JC, Bleicher F, Perrat-Mabillon B, Boudeulle M, Magloire H (2000). Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif Tissue Int 66:129–138.[CrossRef][Medline] [Order article via Infotrieve]
  • Durand SH, Flacher V, Romeas A, Carrouel F, Colomb E, Vincent C, et al. (2006). Lipoteichoic acid increases TLR and functional chemokine expression while reducing dentin formation in in vitro differentiated human odontoblasts. J Immunol 176:2880–2887.[Abstract/Free Full Text]
  • Goldberg M, Smith AJ (2004). Cells and extracellular matrices of dentin and pulp: a biological basis for repair and tissue engineering. Crit Rev Oral Biol Med 15:13–27.[Abstract/Free Full Text]
  • Jernvall J, Thesleff I (2000). Reiterative signaling and patterning during mammalian tooth morphogenesis. Mech Dev 92:19–29.[CrossRef][Medline] [Order article via Infotrieve]
  • Kuo MY, Lan WH, Lin SK, Tsai KS, Hahn LJ (1992). Collagen gene expression in human dental pulp cell cultures. Arch Oral Biol 37:945–952.[CrossRef][Medline] [Order article via Infotrieve]
  • Linde A, Lundgren T (1995). From serum to the mineral phase. The role of the odontoblast in calcium transport and mineral formation. Int J Dev Biol 39:213–222.[Medline] [Order article via Infotrieve]
  • Magloire H, Lesage F, Couble ML, Lazdunski M, Bleicher F (2003). Expression and localization of TREK-1 K+ channels in human odontoblasts. J Dent Res 82:542–545.
  • Mesgouez C, Oboeuf M, Mauro N, Colon P, MacDougall M, Machtou P, et al. (2006). Ultrastructural and immunocytochemical characterization of immortalized odontoblast MO6–G3. Int Endod J 39:453–463.[Medline] [Order article via Infotrieve]
  • Meshorer E, Toiber D, Zurel D, Sahly I, Dori A, Cagnano E, et al. (2004). Combinatorial complexity of 5' alternative acetylcholinesterase transcripts and protein products. J Biol Chem 279:29740–29751.[Abstract/Free Full Text]
  • Pankov R, Yamada KM (2002). Fibronectin at a glance. J Cell Sci 115:3861–3863.[Free Full Text]
  • Ruch JV, Lesot H, Bègue-Kirn C (1995). Odontoblast differentiation. Int J Dev Biol 39:51–68.[Medline] [Order article via Infotrieve]
  • Stanislawski L, Carreau JP, Pouchelet M, Chen ZH, Goldberg M (1997). In vitro culture of human dental pulp cells: some aspects of cells emerging early from the explant. Clin Oral Investig 1:131–140.[Medline] [Order article via Infotrieve]
  • Takagi M, Parmley RT, Denys FR (1981). Ultrastructural localization of complex carbohydrates in odontoblasts, predentin, and dentin. J Histochem Cytochem 29:747–758.[Abstract]
  • Veron MH, Couble ML, Caillot G, Hartmann DJ, Magloire H (1990). Expression of fibronectin and type I collagen by human dental pulp cells and gingiva fibroblasts grown on fibronectin substrate. Arch Oral Biol 35:565–569.[Medline] [Order article via Infotrieve]
  • Veron MH, Couble ML, Magloire H (1993). Selective inhibition of collagen synthesis by fluoride in human pulp fibroblasts in vitro. Calcif Tissue Int 53:38–44.[Medline] [Order article via Infotrieve]
  • Weinstock M, Leblond CP (1974). Synthesis, migration, and release of precursor collagen by odontoblasts as visualized by radioautography after (3H)proline administration. J Cell Biol 60:92–127.[Abstract/Free Full Text]

Journal of Dental Research, Vol. 87, No. 2, 131-136 (2008)
DOI: 10.1177/154405910808700209


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Carrouel, F.
Right arrow Articles by Bleicher, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carrouel, F.
Right arrow Articles by Bleicher, F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?