|
Sign In to gain access to subscriptions and/or personal tools.
|
PDGF Up-regulates CSF-1 Gene Transcription in Ameloblast-like Cells
Y. Wittrant1,
B. Sriniketan Bhandari2,
H. Abboud2,
N. Benson3,
K. Woodruff1,
M. MacDougall4 and
S. Abboud-Werner1,*
1 Departments of Pathology and
2 Medicine, and
3 Dental School, University of Texas Health Science Center, 7703 Floyd Curl Drive, and South Texas Veterans Health Care System, Audie Murphy Division, San Antonio, TX 78229, USA; and
4 School of Dentistry, University of Alabama at Birmingham, Birmingham, AL 35294, USA
Correspondence: * corresponding author, AbboudWerner{at}uthscsa.edu
 |
ABSTRACT
|
|---|
Macrophage colony-stimulating factor (CSF-1) is a key regulatory cytokine for amelogenesis, and ameloblasts synthesize CSF-1. We hypothesized that PDGF stimulates DNA synthesis and regulates CSF-1 in these cells. We determined the effect of PDGF on CSF-1 expression using MEOE-3M ameloblasts as a model. By RT-PCR, MEOE-3M expressed PDGFRs and PDGF A- and B-chain mRNAs. PDGF-BB increased DNA synthesis and up-regulated CSF-1 mRNA and protein in MEOE-3M. Cells transfected with CSF-1 promoter deletion constructs were analyzed. A PDGF-responsive region between –1.7 and –0.795 kb, containing a consensus Pea3 binding motif, was identified. Electrophoretic mobility shift assay (EMSA) showed that PDGF-BB stimulated protein binding to this motif that was inhibited in the presence of anti-Pea3 antibody. Analysis of these data provides the first evidence that PDGF-BB is a mitogen for MEOE-3M and increases CSF-1 protein levels, predominantly by transcription. Elucidation of the cellular pathways that control CSF-1 expression may provide novel strategies for the regulation of enamel matrix formation.
Key Words: macrophage colony-stimulating factor platelet-derived growth factor ameloblasts gene transcription transcription factors
 |
INTRODUCTION
|
|---|
Macrophage colony-stimulating factor (CSF-1) is highly expressed in bone and dental cells and plays a key role in regulating tooth eruption and matrix formation (Wise et al., 2002; Werner et al., 2007). The importance of CSF-1 in amelogenesis has been shown in op/op mice, where the absence of CSF-1 leads to enamel defects. Ameloblasts synthesize CSF-1 in vitro and in vivo (Heinrich et al., 2005). The cellular mechanisms that regulate CSF-1 expression in ameloblasts have not been explored. Previous studies have identified several cytokines that induce CSF-1 expression in various tissue culture systems. For example, IFN- , TNF- , and IL-1 induce CSF-1 mRNA in lung carcinoma and in marrow stromal and endothelial cell lines, respectively (Abboud and Pinzani, 1991; Green and Harrington, 2000; Tsuchimoto et al., 2004). In monocytes, IL-1β and IL-2 increase CSF-1 mRNA and protein, and, in fibroblasts, CSF-1 levels increase in response to IL-1 (Falkenburg et al., 1991; Brach et al., 1993; Gruber et al., 1994). We have shown that BMP-2 up-regulates CSF-1 mRNA and protein in C2C12 cells (Ghosh-Choudhury et al., 2006). In cultured dental follicle cells, IL-1 , PTHrP, and CSF-1 increase CSF-1 mRNA levels (Wise et al., 2002). CSF-1 promoter analysis has indicated that some of these cytokines regulate CSF-1 expression at the transcriptional level.
Platelet-derived growth factor (PDGF) is a peptide essential for embryogenesis and tissue regeneration. In marrow stromal and dental follicle cells, PDGF is a mitogen and enhances CSF-1 expression (Abboud and Pinzani, 1991; Bsoul et al., 2003). Recently, the Ets family of transcription factors has been implicated in PDGF-induced gene transcription (Jinnin et al., 2006). PDGF ligands are composed of 2 subunit proteins (A- and B-chain) that can form disulfide-bonded homo- or heterodimers (PDGF-AA, PDGF-AB, PDGF-BB) (Heldin and Westermark, 1990). These isoforms mediate biologic effects via 2 distinct tyrosine kinase receptors ( andβ). The receptor binds both PDGF A- and B-chains, whereas the β receptor binds only PDGF B (Heldin et al., 1998). In developing mouse molars, immunostained with an antibody that recognizes - and β-receptors, PDGF receptors were detected in ameloblasts, pre-odontoblasts, differentiating odontoblasts, and dental pulp mesenchyme (Hu et al., 1995). In rat molars, pre-ameloblasts and pre-secretory and secretory ameloblasts express PDGF receptors (Tanikawa and Bawden, 1999). By RT-PCR, ameloblasts and dental pulp cells express PDGF-AA transcripts (Hu et al., 1995), and in situ hybridization has identified PDGF-AA transcripts in early ameloblasts and PDGFR in the pulp (Xu et al., 2005). In vitro, cell proliferation increases in molar explants in response to PDGF-AA and in pulp cells treated with PDGF-AA or PDGF-BB (Hu et al., 1995). In the present study, we utilized the mouse MEOE-3M ameloblast-like cell line to explore the hypothesis that PDGF stimulates DNA synthesis and regulates CSF-1 gene transcription in ameloblasts.
 |
MATERIALS & METHODS
|
|---|
Cell Cultures
The MEOE-3M cell line was established by methods previously described (Perez-Reyes et al., 1992). Briefly, enamel organ epithelial cells were isolated from 3-day post-natal Swiss Webster first mandibular molars and immortalized by infection with a retrovirus containing the HPV 16 E6/E7 oncogenes and neomycin resistance gene. Cells were maintained in DMEM (GIBCO, Grand Island, NY, USA) with 10% FCS and 50 µg/mL ascorbic acid. Total RNA was isolated with TRI Reagent (Sigma-Aldrich, St. Louis, MO, USA) and subjected to RT-PCR with specific primer pairs (30 pmol each, APPENDIX Table). Enamel matrix proteins, amelogenin, and ameloblastin served as ameloblast cell markers. To determine if odontoblasts express PDGF, we performed RT-PCR with RNA from odontoblasts isolated from 1-day mouse molars, using laser capture microdissection (LCM) as previously described (Werner et al., 2007).
DNA Synthesis
Cells in complete medium were seeded into 24-well dishes at a density of 1 x 105 cells/well. After 2 days, cells were washed and made quiescent in serum-free DMEM overnight. Cells were incubated with increasing concentrations of PDGF isoforms (R&D, Minneapolis, MN, USA) or albumin (control protein) and pulsed with [3H]-thymidine (TdR) (1.0 µCi/mL) for 4 hrs prior to being harvested at 24 hrs. [3H]-TdR incorporation into DNA was measured as trichloroacetic acid (TCA)-precipitable material (Bsoul et al., 2003).
Northern Blot and CSF-1 Protein Analysis
Cells grown to 80% confluence in complete medium were washed and incubated in serum-free DMEM overnight prior to the addition of PDGF isoforms. At indicated time-points, supernatants were collected for CSF-1 protein, and total RNA was isolated (as per RT-PCR samples). RNA samples were fractionated on 1% agarose-formaldehyde gels, transferred to GeneScreen (New England Nuclear, Boston, MA, USA) and pre-hybridized (Bsoul et al., 2003). The murine CSF-1 cDNA or human 36B4 cDNA that detects a ubiquitously expressed ribosomal phosphoprotein was labeled with 32P-dCTP by means of a random-prime labeling kit. Blots were hybridized for 18 hrs at 42°C, washed, and exposed to AR films at –70°C. Densitometry was performed with ImageJ software (NIH, Bethesda, MD, USA). Cell-free supernatants were analyzed for CSF-1 protein by means of the Quantikine ELISA kit (R&D, Minneapolis, MN, USA).
CSF-1 Promoter Stable Transfections and Transcriptional Assays
Cutback segments of the murine CSF-1 5' flanking region from –2.8 to –0.455 kb, all containing the same 3' endpoint at +183 bp fused to the luciferase reporter gene, were cloned into a pGL3-Basic vector (obtained from E.R. Stanley, Albert Einstein University, Bronx, NY, USA). At 80% confluence, MEOE-3M cells were transfected with the various cutback segments or the promoterless pGL3-Basic vector (0.150 µg DNA/cm2) and pCMV/Hygromycin with Lipofectamine (Invitrogen, Carlsbad, CA, USA). Single cell selection was performed in 0.5 mg/mL hygromycin. Stable transfectants containing each promoter segment were placed in serum-free DMEM overnight, incubated with or without PDGF-BB for 12 hrs, harvested, and assayed for luciferase activity.
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear proteins were extracted from cells with the use of NE-PER Nuclear Extraction Reagents (Pierce Biotechnology, Rockford, IL, USA), and concentrations were determined with the BCA kit (Sigma-Aldrich). EMSA was performed as previously described (Bhandari et al., 1995), with an oligonucleotide (5'CTGAGCTAGGTAGTGCAAGGAAATGGAGGACACGTGA CAA3') spanning the –982/–1021 bp region of the CSF-1 promoter that contains a specific cis-element AGGAAA recognized by Pea3 binding protein, an Ets gene family member. Briefly, EMSA binding reactions were incubated in a 10 µL final volume for 30 min on ice containing 5 µg of nuclear extract, 20–30 fmol of 5' end-labeled double-stranded oligonucleotide, and 0.5 µg of poly (dI-dC)·(dI-dC). Competition was performed in the presence of a 100-fold molar excess of unlabeled oligonucleotide or with a non-specific oligonucleotide (5'AAGGCGAGCAGCTGGCAGAGA3') as competitor. Some incubations contained 2 µL of polyclonal antibodies against Pea3, PU.1, and Elf-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The reaction was carried out on ice for 30 min prior to the addition of the radiolabeled probe. The complexes were resolved in a 6.6% non-denaturing polyacrylamide gel and visualized by autoradiography.
Statistical Analysis
Results were analyzed by one-way ANOVA and Newman-Keuls tests and with Prism4 software (GraphPad, San Diego, CA, USA). Data represent the mean ± SE of 2 or 3 independent experiments. Significance was determined as probability (p) < 0.05.
 |
RESULTS
|
|---|
MEOE-3M Cells Express PDGFRs and PDGF A- and B-chains
MEOE-3M cells express the enamel markers amelogenin and ameloblastin, demonstrating their ameloblast-like phenotype (Fig. 1A ). Cells express transcripts for the and β PDGFRs, as well as the PDGF A-chain and PDGF B-chain transcripts. MEOE-3M cells also express the transcription factor Pea3. Odontoblasts isolated by LCM also showed transcripts for both PDGF isoforms. A wild-type developing incisor expressing each mRNA was used as a control.

View larger version (29K):
[in this window]
[in a new window]
|
Figure 1. Analysis of PDGF in MEOE-3M cells. (A) Expression profile of MEOE-3M cells. Total RNA was isolated from cells in complete medium, and the mRNA expression profile of indicated genes was determined by RT-PCR. PCR products were analyzed in 1% agarose gels stained with ethidium bromide. Normal mouse incisor mRNA was used as a positive control. (B) Dose-response graph for the effect of PDGF-BB or PDGF-AA on MEOE-3M DNA synthesis. Cells in serum-free DMEM were incubated with increasing concentrations of PDGF isoforms and pulsed with [3H]-TdR for 4 hrs prior to being harvested at 24 hrs. Control wells were incubated with SF medium, 20 ng/mL albumin, or 10% FCS alone. Data represent the mean ± SE of 2 separate experiments, each performed in triplicate wells. ***p < 0.001; *p < 0.05 vs. SF medium.
|
|
PDGF Stimulates DNA Synthesis in MEOE-3M Cells
MEOE-3M cells were tested for their ability to incorporate [3H]-TdR into DNA after exposure to PDGF. PDGF-BB stimulated DNA synthesis in a dose-dependent manner (Fig. 1B ). In the presence of 20 ng/mL PDGF-BB, DNA synthesis increased approximately 4.5-fold compared with serum-free medium, and was comparable with that observed with 10% serum. PDGF-AA or albumin had no significant effect on DNA synthesis.
PDGF Up-regulates CSF-1 mRNA and Protein
To determine if PDGF regulates CSF-1, we performed a time-course for the effect of PDGF-BB or PDGF-AA on CSF-1 mRNA. Northern blots of total RNA from cells treated with an optimal concentration of PDGF (20 ng/mL) were hybridized with CSF-1 and 36B4 cDNAs. Autoradiography showed a prominent CSF-1 transcript at 4.0 kb and the 0.7-kb 36B4 transcript (Fig. 2A ). A low-intensity signal was present in unstimulated cells (lane 1). PDGF-BB increased CSF-1 mRNA levels in a time-dependent manner, with a peak effect observed at 6 hrs and subsiding to near-basal levels by 24 hrs. Neither PDGF-AA nor albumin had a significant effect on the level of CSF-1 mRNA (Fig. 2B ). Densitometry analysis confirmed a time-dependent increase in CSF-1 mRNA, with an approximately two- to four-fold increase in PDGF-BB-treated cultures at 6 hrs compared with the control. Quantification of CSF-1 protein in cell-free supernatants showed that unstimulated MEOE-3M secretes CSF-1 protein (Fig. 2C ). PDGF-BB stimulated the secretion of CSF-1 protein in the medium in a time-dependent manner, up to at least 36 hrs. The extended time-course for the increased CSF-1 protein levels, compared with mRNA levels, suggests that PDGF-BB may also enhance CSF-1 protein translation.

View larger version (47K):
[in this window]
[in a new window]
|
Figure 2. Effects of PDGF isoforms on CSF-1 mRNA (A and B, upper panel) in MEOE-3M. Cells were placed in serum-free medium overnight and treated with 20 ng/mL of PDGF-BB, PDGF-AA, or albumin. At indicated time-points, cells were harvested for total RNA. Northern blots (20 µg/lane) were hybridized with 32P-labeled CSF-1 probe; blots were stripped and re-hybridized with a 36B4 probe. Densitometry analysis of Northern blots (A and B, lower panel). Data are expressed as fold change of the ratio of the CSF-1 band to the corresponding 36B4 band in treated cells, compared with control untreated cells, at time 0 or 6 hrs. (C) CSF-1 protein quantification by ELISA. Supernatants were collected for analysis of CSF-1 protein levels from experiments in panel A and at extended time-points. Data represent the mean ± SE of 2 separate experiments. ***p < 0.001; **p < 0.01; *p < 0.05 vs. control.
|
|
Identification of a PDGF-responsive Region in CSF-1 Promoter
To understand the mechanism underlying PDGF-induced CSF-1 gene regulation, we stably transfected MEOE-3M cells with a series of 5'-deletions of the CSF-1 promoter fused to the luciferase reporter gene (Fig. 3A ). Cells were incubated with and without PDGF-BB, and cell extracts were assayed for luciferase activity. PDGF-BB increased transcriptional activity of the 2.8-kb CSF-1 promoter approximately 2.5-fold compared with untreated controls (Fig. 3B ). Deletion of 1.1 kb of upstream sequence in the –1.7-kb fragment partially reduced activity, and further deletion of 0.9 kb of the promoter to –0.795 kb completely abolished transcriptional activity in response to PDGF.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3. Identification of PDGF-BB response region in CSF-1 promoter by deletion analysis. (A) Schematic showing cutback segments of CSF-1 promoter used in panel B. (B) MEOE-3M cells, stably transfected with the indicated deletion constructs, were seeded into 24-well dishes at a density of 1 x 105/well. After 2 days, cells were placed in serum-free DMEM overnight, then incubated with or without PDGF-BB (20 ng/mL) for 12 hrs; cell lysates were assayed for luciferase activity. The bar graph shows the fold increase in promoter activity stimulated by PDGF relative to promoter activity without PDGF. PDGF-BB did not have a significant effect in cells transfected with the empty vector. Data represent the mean ± SE of 3 separate experiments, each performed in triplicate wells. ***p < 0.001 vs. –0.455 kb; (a) p > 0.05 vs. –0.455 kb.
|
|
Characterization of DNA-Protein-binding in Response to PDGF
Deletion analysis indicated the presence of a PDGF-response region within –1.7 and –0.795 kb (GenBank database #M81316). This region was analyzed for cis-acting elements implicated in PDGF-mediated gene transcription, and a putative binding site for the Ets protein, Pea3, with consensus binding sequence AGGAAA was identified from –999 to –1004 bp. EMSA was performed with radiolabeled oligonucleotide encompassing the Pea3 binding site –982/–1021 bp, with nuclear extracts prepared from PDGF-BB-treated and non-treated cells. Two PDGF BB-dependent protein-DNA complexes (A and B) were identified (Fig. 4 , lane 2 vs. lane 3). Incubation of nuclear extracts with an excess of unlabeled specific (lane 4), but not with a non-specific (lane 5), oligonucleotide competed with the radiolabeled probe for binding to the nuclear proteins. To characterize further the DNA-protein interaction and involvement of Pea3, we used specific antibodies for Ets-related factors in EMSA. Results showed that antibodies against Pea3 (lane 6), but not antibodies against PU.1 (lane 7) or Elf-1 (lane 8), inhibited the formation of both protein-DNA complexes (A and B). It is likely that additional transcription factor(s) associate with Pea3, since anti-Pea3 inhibits the formation of both complexes.

View larger version (93K):
[in this window]
[in a new window]
|
Figure 4. Characterization of nuclear protein-DNA complex by EMSA. A double-stranded oligonucleotide representing –982 bp to –1021 bp and containing the AGGAAA sequence was end-labeled with [gamma32P]ATP and incubated without nuclear extract (lane 1) or with nuclear extracts isolated from untreated (lane 2) or PDGF-BB-treated (lanes 3 to 8) cells. For competition analysis, nuclear extracts were incubated with cold specific (SP, lane 4) or non-specific (NSP, lane 5) oligonucleotide (100-fold in excess of the labeled probe) prior to incubation with the radiolabeled probe. Nuclear extracts were incubated with specific antibodies against Pea3 (lane 6), PU.1 (lane 7), or Elf-1 (lane 8) before being incubated with radiolabeled probe. (A, B) Arrows indicate the 2 DNA-protein complexes.
|
|
 |
DISCUSSION
|
|---|
These studies show, for the first time, that MEOE-3M cells express PDGFRs and PDGF-A- and -B-chains. Moreover, PDGF-BB is a potent mitogen and induces CSF-1 expression by a transcriptional mechanism. Our data provide the first evidence of a PDGF-response region in the CSF-1 promoter. We show that Pea3 is present in the DNA-protein complexes formed in response to PDGF-BB. These findings suggest that PDGF is a key determinant of CSF-1 expression that may be important for normal amelogenesis.
PDGF is required for periodontal regeneration (Camelo et al., 2003); however, few studies have examined the biologic role of PDGF in odontogenesis. During murine development, PDGF-AA and PDGFR signaling is essential for tooth cusp and palate morphogenesis (Xu et al., 2005). In vitro, PDGF exerts variable effects on odontoblast differentiation, depending on the isoform (Yokose et al., 2004). We also show that odontoblasts that are close to ameloblasts during tooth formation express PDGF isoforms. Interestingly, the effect of PDGF on CSF-1 mRNA and protein is cell-specific. In smooth-muscle cells, PDGF-BB lowers CSF-1, whereas in skin fibroblasts and stromal cells, it increases CSF-1 (Shimada et al., 1992; Inaba et al., 1995). In dental cells, the effect of PDGF on CSF-1 gene expression has been reported only in dental follicle cells (Bsoul et al., 2003). Our findings in MEOE-3M indicate that PDGF BB, but not PDGF-AA, stimulates proliferation and increases CSF-1 mRNA and protein expression. PDGF-BB, secreted by adjacent cells such as odontoblasts or endothelial cells, likely acts in a short-loop paracrine manner to regulate CSF-1 (Dardik et al., 2005).
Little is known regarding the molecular mechanisms by which cytokines regulate CSF-1 gene transcription. Based upon sequence analysis, there are putative binding sites for numerous transcription factors, including PU.1, SP1/3, CTF/NF, and Ets, in the CSF-1 promoter (Harrington et al., 1997). IFN- increases CSF-1 transcription through a STAT1 binding site (Tsuchimoto et al., 2004), while transcriptional activation of CSF-1 by IL-2 or TNF is associated with enhanced binding of NF-kappa B to its consensus sequence (Yamada et al., 1991; Brach et al., 1993). We have shown that BMP-2 activates CSF-1 transcription via Smads and CREB-binding protein (Ghosh-Choudhury et al., 2006). Previous studies examining the mechanisms involved in PDGF-induced gene transcription have been limited and have implicated serum response elements (Rupprecht et al., 1993) and CREB (Nomiyama et al., 2006). Recently, Jinnin et al.(2006) showed that PDGF induces tenascin-C transcription in fibroblasts by Ets transcription factors. Approximately 30 Ets family members, including Pea3, PU.1, and Elf-1, have been identified. Although all Ets proteins recognize the same core sequence, each protein interacts with unique flanking sequences. These factors control the expression of genes that regulate a variety of biological processes, including proliferation, differentiation, and cell survival (Oettgen, 2006). In situ hybridization has shown that Pea3 is expressed in developing murine tissues (Chotteau-Lelievre et al., 1997; de Launoit et al., 1997), especially during epithelial-mesenchymal interaction, suggesting a key role in murine organogenesis (Liu et al., 2003). Within the toothbud at E13.5, Pea3 is highly expressed in both epithelial and mesenchymal compartments and, at later stages, in early ameloblasts and dental papillae (Chotteau-Lelievre et al., 1997).
Our findings suggest a role for Pea3 in PDGF-BB-mediated CSF-1 gene transcription in MEOE-3M cells. We delineated a PDGF-responsive region in the CSF-1 promoter within –1.7 to –0.795 kb upstream of the transcription start site. EMSAs revealed formation of 2 protein-DNA complexes in response to PDGF-BB, and the use of specific antibodies identified Pea3 in these complexes. The difference in mobility in the 2 complexes containing Pea3 may be due to recruitment of other proteins necessary for CSF-1 expression in response to PDGF. Analysis of the data, taken together, suggests that PDGF-BB, via interaction with its cognant receptors on ameloblasts, leads to enhanced Pea3 binding, CSF-1 gene transcription, and protein expression. This pathway may be critical for epithelial-mesenchymal interactions and may influence the effect of CSF-1 on amelogenesis during tooth development. Elucidation of the mechanisms that control CSF-1 gene expression in ameloblasts may be useful for developing therapeutic strategies to enhance enamel integrity in dental disorders.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by funding from NIH (R01DE015857, SA-W; P01DE13221, M.M.; DE14318, COSTAR). Portions of this work were published in abstract form at the 83rd General Session of the International Association for Dental Research, Baltimore, MD, USA, 9–12 March 2005 (http://iadr.confex.com/iadr/2005Balt/techprogram/abstract_64213.htm).
 |
FOOTNOTES
|
|---|
A supplemental appendix to this article is published electronically only at http://jdr.iadrjournals.org/cgi/content/full/87/1/33/DC1.
Received for publication January 16, 2007.
Revision received September 10, 2007.
Accepted for publication September 25, 2007.
 |
REFERENCES
|
|---|
- Abboud SL, Pinzani M (1991). Peptide growth factors stimulate macrophage colony stimulating factor in murine stromal cells. Blood 78:103–109.[Abstract/Free Full Text]
- Bhandari B, Wenzel UO, Marra F, Abboud HE (1995). A nuclear protein in mesangial cells that binds to the promoter region of the platelet-derived growth factor-A chain gene. Induction by phorbol ester. J Biol Chem 270:5541–5548.[Abstract/Free Full Text]
- Brach MA, Arnold C, Kiehntopf M, Gruss HJ, Herrmann F (1993). Transcriptional activation of the macrophage colony-stimulating factor gene by IL-2 is associated with secretion of bioactive macrophage colony-stimulating factor protein by monocytes and involves activation of the transcription factor NF-kappa B. J Immunol 150:5535–5543.[Abstract]
- Bsoul S, Terezhalmy G, Abboud H, Woodruff K, Abboud SL (2003). PDGF BB and bFGF stimulate DNA synthesis and upregulate CSF-1 and MCP-1 gene expression in dental follicle cells. Arch Oral Biol 48:459–465.[CrossRef][Medline]
[Order article via Infotrieve]
- Camelo M, Nevins ML, Schenk RK, Lynch SE, Nevins M (2003). Periodontal regeneration in human Class II furcations using purified recombinant human platelet-derived growth factor-BB (rhPDGF-BB) with bone allograft. Int J Periodontics Restorative Dent 23:213–225.[Medline]
[Order article via Infotrieve]
- Chotteau-Lelievre A, Desbiens X, Pelczar H, Defossez P-A, de Launoit Y (1997). Differential expression patterns of the PEA3 group transcription factors through murine embryonic development. Oncogene 15:937–952.[CrossRef][Medline]
[Order article via Infotrieve]
- Dardik A, Yamashita A, Aziz F, Asada H, Sumpio BE (2005). Shear stress-stimulated endothelial cells induce smooth muscle cell chemotaxis via platelet-derived growth factor-BB and interleukin-1alpha. J Vasc Surg 41:321–331.[CrossRef][Medline]
[Order article via Infotrieve]
- de Launoit Y, Baert JL, Chotteau A, Monte D, Defossez PA, Coutte L, et al. (1997). Structure-function relationships of the PEA3 groups of Ets-related transcription factors. Biochem Mol Med 61:127–135.[CrossRef][Medline]
[Order article via Infotrieve]
- Falkenburg JH, Harrington MA, de Paus RA, Walsh WK, Daub R, Landegent JE, et al. (1991). Differential transcriptional and posttranscriptional regulation of gene expression of the colony-stimulating factors by interleukin-1 and fetal bovine serum in murine fibroblasts. Blood 78:658–665.[Abstract/Free Full Text]
- Ghosh-Choudhury N, Singha PK, Woodruff K, St Clair P, Bsoul S, Werner SL, et al. (2006). Concerted action of Smad and CREB-binding protein regulates bone morphogenetic protein-2-stimulated osteoblastic colony-stimulating factor-1 expression. J Biol Chem 281:20160–20170.[Abstract/Free Full Text]
- Green M, Harrington MA (2000). A comparison of macrophage colony-stimulating factor (M-CSF) gene expression in primary and immortalized endothelial cells. J Hematother Stem Cell Res 9:237–246.[CrossRef][Medline]
[Order article via Infotrieve]
- Gruber MF, Williams CC, Gerrard TL (1994). Macrophage-colony-stimulating factor expression by anti-CD45 stimulated human monocytes is transcriptionally up-regulated by IL-1 beta and inhibited by IL-4 and IL-10. J Immunol 152:1354–1361.[Abstract]
- Harrington M, Konicek BW, Xia X-L, Song A (1997). Transcriptional regulation of the mouse CSF-1 gene. Mol Reprod Dev 46:39–45.[CrossRef][Medline]
[Order article via Infotrieve]
- Heinrich J, Bsoul S, Barnes J, Woodruff K, Abboud SL (2005). CSF-1, RANKL and OPG regulate osteoclastogenesis during murine tooth eruption. Arch Oral Biol 50:897–908.[Medline]
[Order article via Infotrieve]
- Heldin CH, Westermark B (1990). Platelet-derived growth factor: mechanism of action and possible in vivo function. Cell Regul 1:555–566.[Medline]
[Order article via Infotrieve]
- Heldin CH, Bäckström B, Ostman A, Hammacher A, Rönnstrand L, Rubin K, et al. (1998). Binding of different dimeric forms of PDGF to human fibroblasts: evidence for two separate receptor types. EMBO J 7:1387–1393.
- Hu JC-C, Zhang C, Slavkin HC (1995). The role of platelet-derived growth factor in the development of mouse molars. Int J Dev Biol 39:939–945.[Medline]
[Order article via Infotrieve]
- Inaba T, Kawamura M, Gotoda T, Harada K, Shimada M, Ohsuga J, et al. (1995). Effects of platelet-derived growth factor on the synthesis of lipoprotein lipase in human monocyte-derived macrophages. Arterioscl Thromb Vasc Biol 15:522–528.[Abstract/Free Full Text]
- Jinnin M, Ihn H, Asano Y, Yamane K, Trojanowska M, Tamaki K (2006). Platelet derived growth factor induced tenascin-C transcription is phosphoinositide 3-kinase/Akt-dependent and mediated by Ets family transcription factors. J Cell Physiol 206:718–727.[CrossRef][Medline]
[Order article via Infotrieve]
- Liu Y, Jiang H, Crawford HC, Hogan BLM (2003). Role for ETS domain transcription factors Pea3/Erm in mouse lung development. Dev Biol 261:10–24.[CrossRef][Medline]
[Order article via Infotrieve]
- Nomiyama T, Nakamachi T, Gizard F, Heywood EB, Jones KL, Ohkura N, et al. (2006). The NR4A orphan nuclear receptor NOR1 is induced by platelet-derived growth factor and mediates vascular smooth muscle cell proliferation. J Biol Chem 281:33467–33476.[Abstract/Free Full Text]
- Oettgen P (2006). Regulation of vascular inflammation and remodeling by ETS factors. Circ Res 99:1159–1166.[Abstract/Free Full Text]
- Perez-Reyes N, Halbert CL, Smith PP, Benditt EP, McDougall JK (1992). Immortalization of primary human smooth muscle cells. Proc Natl Acad Sci USA 89:1224–1228.[Abstract/Free Full Text]
- Rupprecht HD, Sukhatme VP, Lacy J, Sterzel RB, Coleman DL (1993). PDGF-induced Egr-1 expression in rat mesangial cells is mediated through upstream serum response elements. Am J Physiol 265(Pt 2):F351–F360.[Medline]
[Order article via Infotrieve]
- Shimada M, Inaba T, Shimano H, Gotoda T, Watanabe Y, Yamamoto K, et al. (1992). Platelet-derived growth factor BB-dimer suppresses the expression of macrophage colony-stimulating factor in human vascular smooth muscle cells. J Biol Chem 267:15455–15458.[Abstract/Free Full Text]
- Tanikawa Y, Bawden JW (1999). The immunohistochemical localization of phospholipase Cgamma and the epidermal growth-factor, platelet-derived growth-factor and fibroblast growth-factor receptors in the cells of the rat molar enamel organ during early amelogenesis. Arch Oral Biol 44:771–780.[CrossRef][Medline]
[Order article via Infotrieve]
- Tsuchimoto D, Tojo A, Asano S (2004). A mechanism of transcriptional regulation of the CSF-1 gene by interferon-gamma. Immunol Invest 33:397–405.[CrossRef][Medline]
[Order article via Infotrieve]
- Werner SA, Gluhak-Heinrich J, Woodruff K, Wittrant Y, Cardenas L, Roudier M, et al. (2007). Targeted expression of csCSF-1 in op/op mice ameliorates tooth defects. Arch Oral Biol 52:432–443.[Medline]
[Order article via Infotrieve]
- Wise GE, Frazier-Bowers S, DSouza RN (2002). Cellular, molecular, and genetic determinants of tooth eruption. Crit Rev Oral Biol Med 13:323–334.[Abstract/Free Full Text]
- Xu X, Bringas P Jr, Soriano P, Chai Y (2005). PDGFR-alpha signaling is critical for tooth cusp and palate morphogenesis. Dev Dyn 232:75–84.[CrossRef][Medline]
[Order article via Infotrieve]
- Yamada H, Iwase S, Mohri M, Kufe D (1991). Involvement of a nuclear factor-kappa B-like protein in induction of the macrophage colony-stimulating factor gene by tumor necrosis factor. Blood 78:1988–1995.[Abstract/Free Full Text]
- Yokose S, Kadokura H, Tajima N, Hasegawa A, Sakagami H, Fujieda K, et al. (2004). Platelet-derived growth factor exerts disparate effects on odontoblast differentiation depending on the dimers in rat dental pulp cells. Cell Tissue Res 315:375–384.[CrossRef][Medline]
[Order article via Infotrieve]
Journal of Dental Research, Vol. 87, No. 1,
33-38 (2008)
DOI: 10.1177/154405910808700105

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati Twitter What's this?
|
|