Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Solomon, L.W.
Right arrow Articles by Kumar, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solomon, L.W.
Right arrow Articles by Kumar, V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Clinical

Autoimmunity to deltaNp63alpha in Chronic Ulcerative Stomatitis

L.W. Solomon1,*, M.E. Neiders2, M.G. Zwick2,3, K.L. Kirkwood4 and V. Kumar3,5

1 Department of Oral and Maxillofacial Pathology, School of Dental Medicine, Tufts University, DHS-646A, One Kneeland Street, Boston, MA 02111-1527, USA;
2 Department of Oral Diagnostic Sciences, School of Dental Medicine, University at Buffalo, SUNY, Buffalo, NY, USA;
3 IMMCO Diagnostics, Inc., Buffalo, NY, USA;
4 Department of Periodontics and Oral Medicine, School of Dentistry, University of Michigan, Ann Arbor, MI; and
5 Departments of Microbiology and Dermatology, University at Buffalo, SUNY, Buffalo, NY, USA

Correspondence: * corresponding author, lynn.solomon{at}tufts.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chronic ulcerative stomatitis (CUS) is a recently described mucocutaneous condition in which patients experience chronic, painful, ulcerative lesions of the oral mucosa. CUS is diagnosed by immunofluorescence studies that demonstrate antinuclear antibodies. These autoantibodies are specific for a protein, deltaNp63alpha, which is normally expressed in basal cell nuclei of stratified squamous epithelia. The purpose of this study was to characterize the autoimmune response in CUS. Protein antigens were produced by in vitro transcription/translation of polymerase chain-reaction (PCR)-amplified cDNAs. We used immunoblotting and immunoprecipitation experiments with serum from CUS patients to examine the (1) antibody isotype, (2) immunogenic functional domains of the deltaNp63alpha antigen, and (3) cross-reactivity with homologous p53, p73, and p63 proteins. Results demonstrate CUS patient antibodies to deltaNp63alpha, and 52% of cases have circulating IgA isotype antibodies. The N-terminal and DNA-binding domains are the immunodominant regions, and antibody cross-reactivity with p53, p63, and p73 isoforms is limited.

Key Words: p63 • chronic ulcerative stomatitis • autoimmunity


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chronic ulcerative stomatitis (CUS) is a painful, debilitating condition that primarily affects the oral mucosa with chronic, exacerbating, and remitting ulcerations. Since CUS is a recently described condition, there are limited numbers of reported cases. The average age of CUS patients is 60 years, and women are most commonly affected (Solomon et al., 2003).

CUS is one of several immunologically mediated conditions that affect the oral cavity, e.g., pemphigoid, pemphigus vulgaris, and lichen planus (Scully and Porter, 1997). Generally, these conditions are successfully managed with corticosteroid therapy (Gonzalez-Moles and Scully, 2005a), and treatment failures often result from incorrect diagnosis (Gonzalez-Moles and Scully, 2005b). In CUS, corticosteroids are less effective than other therapeutics, such as hydroxychloroquine (Chorzelski et al., 1998), underscoring the importance of accurate diagnosis. The histopathologic findings are non-specific, although suggestive features include atrophic, parakeratinized, stratified squamous epithelium, lichenoid inflammatory cell infiltrates, basal cell degeneration, and cytoid bodies (Solomon et al., 2003). Immunofluorescence studies have revealed the presence of autoantibodies with a stratified epithelial specific-antinuclear antibody (SES-ANA) pattern. These autoantibodies target an antigen, deltaNp63alpha, which is a nuclear protein normally present in basal and parabasal cells of stratified squamous epithelia (Lee et al., 1999).

DeltaNp63alpha is a member of a family of nuclear transcription factors, including p63, p73, and the p53 tumor suppressor gene, which share considerable sequence homology (Choi et al., 2002). The homology extends to protein structures, which are characterized by arrangement in functional domains. The N-terminus of domain 1 is generated from the transcriptional start codon and has a transactivating (TA) function. Domain 2 is a DNA-binding domain, while domain 3 is an oligomerization domain. Domain 4 includes the C-terminus. Additional complexity is introduced in p63 and p73 proteins by the production of several isoforms.

When an internal transcriptional start site is used, an N-terminal truncated isoform of domain 1 is created, indicated in writing as "deltaN". Alternate mRNA splicing produces C-termini of various lengths; the specific isoforms are indicated by the addition of a Greek letter suffix, e.g., alpha, beta, gamma. Currently, the convention is to refer to the p63/p73 family members by using the appropriate (TA or deltaN) prefix, and a Greek letter suffix, to identify specific isoforms.

Investigators in several fields independently described the antigen in CUS, deltaNp63alpha; thus, it is found in the literature under several different names (Schmale and Bamberger, 1997; Augustin et al., 1998; Osada et al., 1998; Senoo et al., 1998; Trink et al., 1998; Yang et al., 1998; Lee et al., 1999; Hibi et al., 2000). The p63 gene is located on chromosome 3q27-29 (Yang et al., 1998). The molecular mass of deltaNp63alpha is approximately 70 kDa, and the cDNA has a 1761-bp open reading frame [GenBank accession #AF091627, National Center for Biotechnology Information (NCBI), http://www.ncbi.nlm.nih.gov/]. Various isoforms of p63 are expressed in a tissue-specific manner (Dellavalle et al., 2001).

The present study was undertaken to characterize the autoimmune response in CUS and to provide a potential diagnostic rationale for the use of these autoantibodies. Molecular methods were applied in our study to examine the autoantibody isotype, immunogenic functional domains of the deltaNp63alpha antigen, and cross-reactivity with homologous p53, p73, and p63 proteins.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Serum Samples
Serum samples from 21 CUS patients, diagnosed by clinical, histologic, and immunofluorescence findings, were obtained as generous gifts from Dr. Stephania Jablonska (Katedra i Klinika Dermatologiczna, Warsaw, Poland) and from IMMCO Diagnostics. Dr. Jablonska is supportive of this investigation and gave permission to publish the results. Control sera from IMMCO Diagnostics included 16 samples from patients with dermatologic or rheumatic clinical conditions. All sera were existing diagnostic samples and thus exempt from human subjects review, as provided for research involving "the collection or study of existing diagnostic specimens, if the information is recorded by the investigator in a manner that the subjects cannot be identified, directly or through identifiers linked to the subjects". Additional information is available at http://www.hhs.gov/ohrp/humansubjects/guidance/45cfr46.htm#46.101, the US Department of Health & Human Services Web site.

Primer Design and PCR Amplification of deltaNp63alpha and Domains
The source of cloned deltaNp63alpha and primer design for PCR amplification of full-length deltaNp63alpha protein have been previously described (Solomon et al., 2003). Functional domain sequences of deltaNp63alpha were identified by comparison with functional domain sequences of p53 (Yang et al., 1998; Lee et al., 1999; Levrero et al., 1999). The nucleotide (nt) numbers of the deltaNp63alpha domains are: domain 1, nt #’s 1-79/domain 2, nt #’s 80-275/domain 3, nt #’s 276-385/domain 4, nt #’s 386-587.

Primer sets were designed for PCR amplification of functional domains: domain 1F (5'-GGATCCTAATACGACTCACTAT AGGGAACAGCTAACATGTTGTACCTGGAA-3') and domain 1R (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAC TTTTTCTTACAGCTAACATGTTGTACCTGGAA-3'); domain 2F (5'-GGATCCTAATACGACTCACTATAGGGAACAG CTAACATGCCGCACAGTTTCGACGTGTCCT-3') and domain 2R (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACTTT GTACTGTCCGAAACTTGCTG-3'); domain 3F (5'-GGATCCTAATACGACTCACTATAGGGAACAGCTAACATG CCGCACAGTTTCGACGTGTCCT-3') and domain 3R (5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACTTTGTACTG TCCGAAACTTGCTG-3'; domain 4F (5'-GGATCCTAATA CGACTCACTATAGGGAACAGCTAACATGACAGCTAACAT GTTGTACCTGGAA-3') and domain 4R (5'-TTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTCACTCCCCCTCCTCTTTGATGC-3').

Incorporation of transcription and poly A translational signaling sequences, e.g., the oligo dT stretch (Beckler et al., 2000), resulted in a primer length longer than usual. Gel-purified primers (Integrated DNA Technologies, Coralville, IA, USA) and AccuPrimeTM Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) were used in a GeneAmp® thermal-cycler (PE Applied Biosystems, Foster City, CA, USA) as per manufacturers’ instructions under standard conditions (Saiki, 1990). Combination domains—1&2, 2&3, 3&4, 1,2&3, and 2,3&4—were created with appropriate primers.

In vitro Transcription/Translation (IVTT)
We used the TNT® T7 Quick for PCR DNA System, TranscendTM Biotinylated tRNA (Promega Corporation, Madison, WI, USA) and PCR-amplified DNA to produce biotinylated full-length deltaNp63alpha and functional domains in rabbit reticulocyte lysate (Weinhofer et al., 2002). SDS-PAGE and Western blot with streptavidin/alkaline phosphatase (Promega) and Western Blue® Alkaline Phosphatase Substrate (Promega) demonstrated successful production of biotinylated proteins.

Western Immunoblot
For identification of immunologic reactivity, IVTT-produced proteins were immunoblotted (Targoff et al., 1993) with human sera (1:50 dilution) or anti-human p63 monoclonal antibody 4A4 (1:500 dilution) (Oncogene Research Products, San Diego, CA, USA). Alkaline phosphatase-conjugated 2° antibodies (1:1000 dilution) were either: Donkey Anti-Human IgG (H+L) AffiniPure F(ab')2 Fragment (cat. #709-056-149), Goat Anti-Human Serum IgA, {alpha}-chain-specific (cat. #109-056-011), or Goat Anti-Mouse IgG (H+L) AffiniPure (cat. #115-055-062), all from the same source (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Western Blue® Substrate for Alkaline Phosphatase (Promega) was used to develop color.

Immunoprecipitation
Approximately 45 ng of biotinylated IVTT-produced protein was incubated with serum from individual patients. Full-length deltaNp63alpha, domains 1, 2, 3, and 4, and combination domains 1&2, 2&3, and 3&4 were tested individually. Antibody-bound proteins were precipitated with Immunopure Immobilized Protein L Gel (Pierce Biotechnology, Rockford, IL, USA) (Tominaga et al., 2001) and separated by SDS-PAGE. After electrotransfer to nitrocellulose membranes and incubation with streptavidin/alkaline phosphatase (Promega), color was developed with Western Blue® Substrate for Alkaline Phosphatase (Promega).

Cross-reactivity of CUS Patient Antibodies with p53, p63, and p73 Isoforms
Cloned p53 was obtained from Drs. David Sidransky and Edward Ratovitsky (Johns Hopkins University, Baltimore, MD, USA). Cloned TAp63alpha was obtained from Drs. Frank McKeon and Annie Yang (Harvard Medical School, Boston, MA, USA). Clones of TAp73alpha, TAp73gamma, TAp73delta, deltaNp73alpha, deltaNp73beta, and deltaNp73gamma were obtained from Dr. Gerry Melino (University of Rome, Italy). TNT® T7 Quick Coupled Transcription/Translation System for Plasmid DNA (Promega) and TranscendTM Biotinylated tRNA (Promega) were used to produce biotinylated proteins directly from plasmids (Bazzoni et al., 2000).

Proteins were subjected to SDS-PAGE, electrotransferred to nitrocellulose membranes, and incubated with streptavidin/alkaline phosphatase and substrate to demonstrate successful IVTT. For detection of immunologic reactivity, duplicate membranes were immunoblotted with human sera (1:50 dilution). After being washed, membranes were incubated with alkaline phosphatase-conjugated donkey anti-human IgG secondary antibody (Jackson Laboratories) and subsequently with Western Blue® Substrate for Alkaline Phosphatase (Promega).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Western Immunoblot
All of the CUS patient sera were immunologically reactive with deltaNp63alpha protein (Fig., AGo). However, donkey anti-human IgG (H+L) secondary antibody also reacts with IgM and IgA, which share light chains; thus we cannot conclude that the patient antibodies are exclusively IgG. Immunoblotting with IgA isotype-specific secondary antibody showed that 52% of the sera were positive, and 48% were negative for IgA antibodies to deltaNp63alpha (Fig., B). None of the control sera was immunologically reactive with deltaNp63alpha (Fig., C). Positive results were identified based on visual detection of a reactive band.


Figure 1
View larger version (81K):
[in this window]
[in a new window]

 
Figure. All CUS sera studied have antibodies to {Delta}Np63{alpha}, and 52% have serum IgA. Western transfers of deltaNp63alpha protein, produced by in vitro transcription/translation, were immunoblotted with sera. (A,B) Results from 21 different CUS patient sera (numbered lanes) and the mAb 4A4. [Lane #/serum #, as follows: 1/572, 2/3069, 3/4045, 4/4787, 5/4792, 6/9264, 7/8985, 8/9035, 9/8051, 10/5742, 11/622, 12/8216, 13/S.J., 14/180, 15/1631, 16/10808, 17/512; 18E47; 19/E67; 20/E81; 21/IM0017.] (A) All of the sera have antibodies to deltaNp63alpha protein. (B) Eleven of the 21 sera have IgA antibodies detected with goat anti-human IgA secondary antibody. (C) Control sera tested were 16 diagnostic samples from patients with clinical dermatologic or rheumatic conditions. None of the controls had antibodies to deltaNp63alpha protein. mAb = monoclonal antibody, MW = molecular-weight marker.

 
Immunoblotting of functional domains showed that all CUS sera tested recognized common deltaNp63alpha domains, although individual sera varied. The results are summarized (Table 1Go). Functional domain combinations served to confirm results of the individual domains. Domain 1 is a small peptide and did not express well in IVTT; thus it was unable to be tested individually. However, since 5 of 6 sera tested recognized combination domains 1&2, and none recognized domain 2, it is reasonable to assume that domain 1 must be the antigenic epitope. These results show that the antigenic epitopes of linearized peptides are domains 1 and 4, the N- and C-termini, respectively.


View this table:
[in this window]
[in a new window]

 
Table 1. CUS Patient Antibodies Recognize Certain {Delta}Np63{alpha} Domains*
 
Immunoprecipitation
Our experiments showed that all CUS patient sera tested had antibodies that immunoprecipitated folded domains of deltaNp63alpha protein. However, Protein L was not isotype-specific; thus we cannot conclude that these antibodies are exclusively IgG. Visual detection of a reactive band identified positive results. The results summary (Table 2Go) shows that all CUS sera strongly recognized domain 2 and combination domain 1&2 in folded conformations. Only 1 of 8 sera showed weak positive recognition of domain 3. Domain 4 was strongly recognized by 2 sera, and 5 sera produced a weak band. Of 8 samples tested, 3 recognized combination domains 3&4 with a strong band, and 3 produced a weak band. Domain 1 was unable to be tested individually. These results indicate that folded domain 2 is the most strongly antigenic epitope. Folded domain 4 is also antigenic, although not as strongly or frequently.


View this table:
[in this window]
[in a new window]

 
Table 2. Immunoprecipitation of Folded {Delta}Np63{alpha} Domains and Full-length Protein with CUS Patient Sera*
 
Cross-reactivity of CUS Patient Antibodies with p53, p63, and p73 Isoforms
Homologous deltaNp63alpha proteins—specifically p53, TAp73alpha, TAp73-gamma, TAp73delta, deltaNp73alpha, deltaNp73beta, deltaNp73gamma, and TAp63alpha—were produced with IVTT. Visual detection of a reactive band identified positive results. The results summary (Table 3Go) shows that all CUS sera tested were immunologically reactive with the p63 isoform TAp63alpha. Two sera recognized additional isoforms, one recognizing TAp73alpha and delta-Np73alpha, while the other reacted with the TAp73gamma isoform. One serum was extremely cross-reactive, recognizing all p73 and p63 isoforms tested, although it did not recognize p53. The secondary antibody used, donkey anti-human IgG (H+L), also reacts with IgM and IgA, which share light chains; thus we cannot conclude that the patient antibodies are exclusively IgG. Ten duplicate blots were created for controls; all control sera were negative for immunologic reactivity with any of the isoforms (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 3. Limited Cross-reactivity to p63 and 73 Isoforms, and No Immunoreactivity to p53, Exhibited by CUS Patient Sera*
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In our studies, we used in vitro systems to produce deltaNp63alpha, discrete functional domains, and homologous proteins. Immunoblotting and immunoprecipitation experiments with CUS patient sera determined the (1) presence of autoantibodies, (2) immunogenic functional domains, and (3) cross-reactivity with homologous p53, p73, and p63 proteins.

In vitro systems employed to produce proteins used rabbit reticulocyte lysates, because they produce appropriate mammalian-type post-translational protein modification and folding. The IVTT-produced proteins were biotinylated to aid detection, and it is possible that addition of this small molecule may have affected epitope reactivity. Thus, our results should be confirmed with an independent method to determine immunogenic epitopes conclusively.

Immunological reactivity to deltaNp63alpha was shown with all sera examined by immunoblotting. The presence of IgA antibodies in CUS patient sera has not previously been studied, and 52% of samples had circulating IgA immunoreactive with deltaNp63alpha. In mucous membrane pemphigoid, circulating IgA is clinically significant; patients with dual circulating IgG and IgA responses have more severe disease (Setterfield et al., 1998). Future studies to determine if CUS patients with circulating IgA have disease clinically more severe would be useful.

Linear epitopes are detected by immunoblot, and conformational epitopes are detected by immunoprecipitation. Immunoblotting confirmed antibodies to linearized epitopes of functional domains 1 and 4. In contrast, immunoprecipitation showed that the most strongly immunogenic region was a conformational epitope of functional domain 2. It is not unexpected that multiple epitopes are recognized, since the normal immune response is polyclonal. The tissue milieu in CUS is inflammatory, and proteins are degraded; thus, linear sequences, in addition to conformational epitopes, may become immunogenic.

This work is the first to examine cross-reactivity of CUS patient antibodies with p53 family isoforms. DeltaNp63alpha exhibits various homologies to other p53, p63, and p73 proteins. p53 and p63 share 60% and 37% identical residues in functional domains 2 and 3, respectively (Barbieri and Pietenpol, 2006). Amino acid sequence comparison between p63alpha and p73alpha shows 85%, 60%, and 50% homology between functional domains 2, 3, and 4, respectively (Yang et al., 2002). All CUS sera tested cross-reacted with TAp63alpha, which is not surprising, since there is only a small N-terminal difference between TA- and deltaN- p63alpha. Most sera exhibited limited cross-reactivity to p63 and 73 isoforms, while none cross-reacted with p53.

DeltaNp63alpha is the p63 isoform preferentially expressed in stratified squamous epithelia, where it is essential for differentiation (Koster et al., 2004) and the maintenance of progenitor cell populations to sustain development, morphogenesis, and the proliferative potential (Ratovitski et al., 2001; Marchbank et al., 2003; Barbieri and Pietenpol, 2006). Homology between p53 family members allows for binding to consensus DNA sequences (Yang et al., 2002), and deltaN isoforms exert dominant-negative effects over p53, p63, and p73 activities (Murray-Zmijewski et al., 2006). Another p63 function is maintenance of epithelial integrity via regulation of desmosomal adhesion complex stability (Ihrie et al., 2005).

While CUS patient antibodies to deltaNp63alpha are demonstrated within basal cell nuclei in vivo, their role in pathogenesis is unknown. Several studies support the intracellular and intranuclear penetration of antibodies, although not without controversy (Alarcon-Segovia et al., 1996; Reichlin, 1998; Rivadeneyra-Espinoza and Ruiz-Arguelles, 2006). It is interesting to speculate that CUS autoantibodies to the DNA-binding domain may interfere with the ability of deltaNp63alpha to oppose apoptosis and maintain epithelial integrity. This may be especially significant in the oral cavity, where epithelial turnover is high, and the site is frequently exposed to minor trauma.

These results have importance when one considers that, currently, the gold standard in diagnosis of immunologically mediated conditions is immunofluorescence. The facilities to perform these studies are limited, and the tests are costly. As a result, many oral ulcerative conditions are treated empirically, without a diagnosis; thus, the true incidence and prevalence of many of these conditions, including CUS, are unknown. Future development of a simple immunoassay may help to establish the true incidence and prevalence of CUS and allow for meaningful comparisons of treatment efficacies.


    ACKNOWLEDGMENTS
 
This paper is based in part on a thesis submitted to the faculty of the Graduate School of the University at Buffalo in partial fulfillment of the requirements for the degree of Master of Science in the Oral Sciences. The financial support of IMMCO Diagnostics, Inc., Buffalo, NY, is gratefully acknowledged.

Received for publication March 6, 2006. Revision received February 20, 2007. Accepted for publication April 15, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Alarcon-Segovia D, Ruiz-Arguelles A, Llorente L (1996). Broken dogma: penetration of autoantibodies into living cells. Immunol Today 17:163–164.[Medline] [Order article via Infotrieve]
  • Augustin M, Bamberger C, Paul D, Schmale H (1998). Cloning and chromosomal mapping of the human p53-related KET gene to chromosome 3q27 and its murine homolog Ket to mouse chromosome 16. Mamm Genome 9:899–902.[CrossRef][Medline] [Order article via Infotrieve]
  • Barbieri CE, Pietenpol JA (2006). p63 and epithelial biology. Exp Cell Res 312:695–706.[CrossRef][Medline] [Order article via Infotrieve]
  • Bazzoni G, Martinez-Estrada OM, Orsenigo F, Cordenonsi M, Citi S, Dejana E (2000). Interaction of junctional adhesion molecule with the tight junction components ZO-1, cingulin, and occludin. J Biol Chem 275:20520–20526.[Abstract/Free Full Text]
  • Beckler G, Zwick M, Hurst R, Stupfel J, Drewieck M, Godat B, et al. (2000). A new TNT system for enhanced expression of PCR DNA. Promega Notes 74:10–13.
  • Choi HR, Batsakis JG, Zhan F, Sturgis E, Luna MA, El-Naggar AK (2002). Differential expression of p53 gene family members p63 and p73 in head and neck squamous tumorigenesis. Hum Pathol 33:158–164.[CrossRef][Medline] [Order article via Infotrieve]
  • Chorzelski TP, Olszewska M, Jarzabek-Chorzelska M, Jablonska S (1998). Is chronic ulcerative stomatitis an entity? Clinical and immunological findings in 18 cases. Eur J Dermatol 8:261–265.[Medline] [Order article via Infotrieve]
  • Dellavalle RP, Egbert TB, Marchbank A, Su LJ, Lee LA, Walsh P (2001). CUSP/p63 expression in rat and human tissues. J Dermatol Sci 27:82–87.[CrossRef][Medline] [Order article via Infotrieve]
  • Gonzalez-Moles MA, Scully C (2005a). Vesiculo-erosive oral mucosal disease—management with topical corticosteroids: (1) fundamental principles and specific agents available. J Dent Res 84:294–301.
  • Gonzalez-Moles MA, Scully C (2005b). Vesiculo-erosive oral mucosal disease—management with topical corticosteroids: (2) protocols, monitoring of effects and adverse reactions, and the future. J Dent Res 84:302–308.
  • Hibi K, Trink B, Patturajan M, Westra WH, Caballero OL, Hill DE, et al. (2000). AIS is an oncogene amplified in squamous cell carcinoma. Proc Natl Acad Sci USA 97:5462–5467.[Abstract/Free Full Text]
  • Ihrie RA, Marques MR, Nguyen BT, Horner JS, Papazoglu C, Bronson RT, et al. (2005). Perp is a p63-regulated gene essential for epithelial integrity. Cell 120:843–856.[CrossRef][Medline] [Order article via Infotrieve]
  • Koster MI, Kim S, Mills AA, DeMayo FJ, Roop DR (2004). p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev 18:126–131.[Abstract/Free Full Text]
  • Lee LA, Walsh P, Prater CA, Su LJ, Marchbank A, Egbert TB, et al. (1999). Characterization of an autoantigen associated with chronic ulcerative stomatitis: the CUSP autoantigen is a member of the p53 family. J Invest Dermatol 113:146–151.[CrossRef][Medline] [Order article via Infotrieve]
  • Levrero M, De Laurenzi V, Costanzo A, Gong J, Melino G, Wang JY (1999). Structure, function and regulation of p63 and p73. Cell Death Differ 6:1146–1153.[CrossRef][Medline] [Order article via Infotrieve]
  • Marchbank A, Su LJ, Walsh P, DeGregori J, Penheiter K, Grayson TB, et al. (2003). The CUSP DeltaNp63alpha isoform of human p63 is downregulated by solar-simulated ultraviolet radiation. J Dermatol Sci 32:71–74.[CrossRef][Medline] [Order article via Infotrieve]
  • Murray-Zmijewski F, Lane DP, Bourdon JC (2006). p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ 13:962–972.[CrossRef][Medline] [Order article via Infotrieve]
  • Osada M, Ohba M, Kawahara C, Ishioka C, Kanamaru R, Katoh I, et al. (1998). Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat Med 4:839–843.[CrossRef][Medline] [Order article via Infotrieve]
  • Ratovitski EA, Patturajan M, Hibi K, Trink B, Yamaguchi K, Sidransky D (2001). p53 associates with and targets Delta Np63 into a protein degradation pathway. Proc Natl Acad Sci USA 98:1817–1822.[Abstract/Free Full Text]
  • Reichlin M (1998). Cellular dysfunction induced by penetration of autoantibodies into living cells: cellular damage and dysfunction mediated by antibodies to dsDNA and ribosomal P proteins. J Autoimmun 11:557–561.[CrossRef][Medline] [Order article via Infotrieve]
  • Rivadeneyra-Espinoza L, Ruiz-Arguelles A (2006). Cell-penetrating anti-native DNA antibodies trigger apoptosis through both the neglect and programmed pathways. J Autoimmun 26:52–56.[CrossRef][Medline] [Order article via Infotrieve]
  • Saiki RK (1990). Amplification of genomic DNA. In: PCR protocols: a guide to methods and applications. Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. San Diego: Academic Press, pp. 13–20.
  • Schmale H, Bamberger C (1997). A novel protein with strong homology to the tumor suppressor p53. Oncogene 15:1363–1367.[CrossRef][Medline] [Order article via Infotrieve]
  • Scully C, Porter SR (1997). The clinical spectrum of desquamative gingivitis. Semin Cutan Med Surg 16:308–313.[Medline] [Order article via Infotrieve]
  • Senoo M, Seki N, Ohira M, Sugano S, Watanabe M, Inuzuka S, et al. (1998). A second p53-related protein, p73L, with high homology to p73. Biochem Biophys Res Commun 248:603–607.[CrossRef][Medline] [Order article via Infotrieve]
  • Setterfield J, Shirlaw PJ, Kerr-Muir M, Neill S, Bhogal BS, Morgan P, et al. (1998). Mucous membrane pemphigoid: a dual circulating antibody response with IgG and IgA signifies a more severe and persistent disease. Br J Dermatol 138:602–610.[CrossRef][Medline] [Order article via Infotrieve]
  • Solomon LW, Aguirre A, Neiders M, Costales-Spindler A, Jividen GJ Jr, Zwick MG, et al. (2003). Chronic ulcerative stomatitis: clinical, histopathologic, and immunopathologic findings. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 96:718–726.[Medline] [Order article via Infotrieve]
  • Targoff IN, Trieu EP, Miller FW (1993). Reaction of anti-OJ autoantibodies with components of the multi-enzyme complex of aminoacyl-tRNA synthetases in addition to isoleucyl-tRNA synthetase. J Clin Invest 91:2556–2564.[Medline] [Order article via Infotrieve]
  • Tominaga O, Unsal K, Zalcman G, Soussi T (2001). Detection of p73 antibodies in patients with various types of cancer: immunological characterization. Br J Cancer 84:57–63.[CrossRef][Medline] [Order article via Infotrieve]
  • Trink B, Okami K, Wu L, Sriuranpong V, Jen J, Sidransky D (1998). A new human p53 homologue. Nat Med 4:747–748.[CrossRef][Medline] [Order article via Infotrieve]
  • Weinhofer I, Forss-Petter S, Zigman M, Berger J (2002). Cholesterol regulates ABCD2 expression: implications for the therapy of X-linked adrenoleukodystrophy. Hum Mol Genet 11:2701–2708.[Abstract/Free Full Text]
  • Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dotsch V, et al. (1998). p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 2:305–316.[CrossRef][Medline] [Order article via Infotrieve]
  • Yang A, Kaghad M, Caput D, McKeon F (2002). On the shoulders of giants: p63, p73 and the rise of p53. Trends Genet 18:90–95.[CrossRef][Medline] [Order article via Infotrieve]

Journal of Dental Research, Vol. 86, No. 9, 826-831 (2007)
DOI: 10.1177/154405910708600904


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Solomon, L.W.
Right arrow Articles by Kumar, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solomon, L.W.
Right arrow Articles by Kumar, V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?