Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Maeda, A.
Right arrow Articles by Matsuguchi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maeda, A.
Right arrow Articles by Matsuguchi, T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Force-induced IL-8 from Periodontal Ligament Cells Requires IL-1β

A. Maeda1, K. Soejima1, K. Bandow2, K. Kuroe1, K. Kakimoto2, S. Miyawaki1, A. Okamoto1 and T. Matsuguchi2,*

1 Department of Orthodontics, and
2 Department of Biochemistry and Molecular Dentistry, Field of Developmental Medicine, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8544, Japan

Correspondence: * corresponding author, tmatsugu{at}denta.hal.kagoshima-u.ac.jp


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
During orthodontic tooth movement, mechanical stresses induce inflammatory reactions in the periodontal ligament (PDL). We hypothesized that chemokines released from PDL cells under mechanical stress regulate osteoclastogenesis, and investigated the profiles and mechanisms of chemokine expression by human PDL cells in response to mechanical stress. In vitro, shear stress and pressure force rapidly increased the gene and protein expressions of IL-8/CXCL8 by PDL cells. Consistently, amounts of IL-8 in the gingival crevicular fluid of healthy individuals increased within 2 to 4 days of orthodontic force application. The PDL cells constitutively expressed low levels of IL-1β, which were not further increased by mechanical stress. Interestingly, neutralization of IL-1β abolished IL-8 induction by mechanical stresses, indicating that IL-1β is essential for IL-8 induction, presumably though autocrine or paracrine mechanisms. Finally, experiments with signal-specific inhibitors indicated that MAP kinase activation is essential for IL-8 induction.

Key Words: orthodontics • IL-8 • IL-1β • periodontal ligament cell • mechanical stress


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The early phase of orthodontic load is transduced into the periodontal ligament (PDL). Several lines of evidence have indicated that PDL cells respond to the mechanical load and regulate the resorption and formation of bone matrix by signaling to the surrounding cells (Davidovitch, 1991; Shimizu et al., 1994, 1998; Long et al., 2001). Notably, PDL cells under mechanical stress synthesize cytokines and growth factors, which may regulate osteoclast functions (Davidovitch, 1991; Long et al., 2001). Various cytokines, such as interleukin (IL)-1β, IL-6, interferon-{gamma}, and tumor necrosis factor-{alpha} (TNF-{alpha}), were reported to be involved in orthodontic tooth movement in animal and human studies (Davidovitch, 1991; Lowney et al., 1995; Uematsu et al., 1996).

Chemokines form a family of structurally related chemoattractant proteins. In general, CC chemokines (including MCP-1, MIP-1{alpha}, and RANTES) and CXC chemokines (including IL-8) are potent chemoattractants for monocytes and neutrophils, respectively. Chemokines are produced by various cell types in response to bacterial and viral products and physical damage to the tissue. In a rat orthodontic model, MCP-1, RANTES, and MIP-2 expressions have been reported to be significantly increased (Alhashimi et al., 1999).

We hypothesized that chemokines released from PDL cells under mechanical stress may regulate the metabolism of the surrounding bone matrix. The goals of this study were: (1) to examine the gene and protein expression profiles of chemokines in human PDL cells under shear stress and pressure force; (2) to measure chemokine concentrations in the gingival crevicular fluid (GCF) of healthy individuals stimulated by orthodontic force; and (3) to analyze the molecular mechanisms of chemokine expression in human PDL cells.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
Specific inhibitors of p38 kinase (SB203580), JNK (SP600125), and ERK (U0126)/NF-{kappa}B (MG132) were obtained from Santa Cruz Biotech (Santa Cruz, CA, USA), BIOMOL international, L.P. (Plymouth Meeting, PA, USA), and CALBIOCHEM (San Diego, CA, USA), respectively. The ELISA kit for IL-8 was obtained from Biosource International (Camarillo, CA, USA). The ELISA kits for MIP-1{alpha} and RANTES, and a neutralizing anti-IL-1β monoclonal antibody (500-M01B) were obtained from PeproTechEC, Ltd. (London, UK).

Human PDL Cells
To exclude the intermixture of gingivae and dental pulp, we obtained PDL exclusively from the middle of tooth roots extracted for orthodontic reasons. Ligament samples were then cultured in {alpha}-MEM with 10% FBS, and the PDL cells were used for experiments after 3 or 4 passages. The protocol was reviewed and approved by the Kagoshima University School of Dentistry Research Ethics Committee, and informed consent was obtained from all participants.

Shear Stress Application by Pulsating Fluid Flow
Shear stress was applied with a flow apparatus as previously described (Klein-Nulend et al., 1995). Briefly, PDL cells were plated onto 50 µg/mL poly-L-lysine-pre-coated (Sigma, St. Louis, MO, USA) glass slides at 5 x 105 cells/slide and incubated in 15 mL {alpha}-MEM with 10% FBS until confluence. The pulsating flow was applied at 5 Hz for 30 min, generating a shear stress of 0.6 ± 0.3 Pa. The shear stress at this magnitude has been demonstrated to be sufficient to induce significant nitric oxide (NO) responses in both mouse bone cells (Bakker et al., 2001) and human PDL cells (van der Pauw et al., 2000). Longer treatments of the same magnitude did not induce any further responses. During experiments, all components were placed at 37°C, and the reservoir was connected to a gassing system that maintained a humidified atmosphere of 5% CO2 in air.

Application of Pressure Force by Centrifugation
Confluent PDL cell culture dishes were centrifuged at 10 g/cm2 (475 rpm) for 20 min. The pressure force of 10 g/cm2 was chosen because it mimics clinical orthodontic force (Redlich et al., 2004), and was more effective than weaker (3 g/cm2) and stronger (30 g/cm2) pressure forces in the preliminary experiments (data not shown). Longer treatments of the same magnitude did not induce any further responses.

Real-time Polymerase Chain-reaction (PCR) Assay
Quantitative real-time PCR was performed with SYBR® Green I (CAMBREX, Rockland, ME) in RG-2000 (Corbett Research, Mortlake, NSW, Australia). The primer sequences were: IL-8 forward, ATGACTTCCAAGCT GGCCGTGGCT, reverse, TCTC AGCCCTCTTCAAAAA CTTCT (292 bp); MIP-1{alpha} forward, CATCACTTGCTGCTGACACG, reverse, TGTGGAATCTGCC GGGAG (63 bp); RANTES forward, TACACCAGTGGC AAGTGCTC, reverse, GAAGCCT CCCAAGCTAGGAC (199 bp); MCP-1 forward, CTGCCCTTG CTGTCCTCCTCTG, reverse, CTGCCGGCTTCGCTTGGTTA (297 bp); IL-1β forward, GGCAGAAAGGGAACAGAAA GG, reverse, AGTGAG TAGGAGAGGTGAGAGAGG (200 bp); and GAPDH forward, CATCACCATCTTCCAGGAGC, reverse, CATGAGTCCTT CCACGATACC (307 bp). Annealing temperature was 55°C (GAPDH, IL-8, RANTES) or 58°C (MIP-1{alpha}, MCP-1, IL-1β).

Western Blotting
Cells underwent lysis in RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, pH 7.5). The Western blotting procedure was previously described (Matsuguchi et al., 2003).

Gingival Crevicular Fluid (GCF) Collection
Ten healthy individuals (seven females and three males, age range from 23 to 30 yrs; mean, 26.2 ± 2.3), who gave written informed consent, were included in the study, which was approved by the Ethics Committee of Research on Human Beings of Kagoshima University. They met the following criteria: good general health; no antibiotic therapy within the past 6 mos; no use of anti-inflammatory drugs in the month preceding the study; and good periodontal health, with generalized probing depths ≤ 3 mm, gingival index = 0, and PCR ≤ 20%. The maxillary right canine was moved in the mesial direction by means of 3 elastic modules (3M Unitek, Monrovia, CA, USA) inserted interdentally from the maxillary right first premolar to the right second molar. GCF was collected from the mesial gingival crevice of the canine by 2 paper strips and was extracted in PBS as previously described (Kakimoto et al., 2002).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemokine Expression in PDL Cells Induced by Shear Stress and Pressure Force
PDL cells isolated from the tooth roots of five orthodontic patients were exposed to shear stress and pressure force, and mRNA expression for 4 chemokines (IL-8, MIP-1{alpha}, RANTES, and MCP-1) was quantified by real-time PCR. Two typical results (cell lines 1 and 2) are shown (Figs. 1AGo, 2AGo). PDL lines constitutively expressed small amounts of IL-8, MIP-1{alpha}, and RANTES mRNA. MCP-1 mRNA was undetectable at any time-point. IL-8 mRNA significantly increased at 1.5 or 2.5 hrs, and remained elevated until 6.5 hrs after each treatment in all PDL lines. MIP-1{alpha} mRNA was significantly decreased by shear stress and temporarily increased by pressure force (at 2.5 hrs) in 1 cell line (line 1), but remained unchanged in the other (line 2) (Figs. 1AbGo, 2AbGo). Some variations were observed for RANTES mRNA after shear stress and pressure treatments in both PDL cell lines (Figs. 1AcGo, 2AcGo), but the fold differences were much less than those for IL-8 mRNA.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
Figure 1. Effect of shear stress on chemokine mRNA and protein expression by PDL cells. (A) PDL cells were stimulated by pulsating fluid flow (0.6 Pa, 30 min) (lines 1 and 2), or were unstimulated (line 1), followed by incubation for 1.5–6.5 hrs in 15 mL of fresh medium ({alpha}-MEM supplemented with 10% FBS) for total RNA collection. IL-8 (a), MIP-1{alpha} (b), and RANTES (c) mRNA levels were quantified by real-time PCR. (B) The concentration of IL-8 in culture media of PDL line 1 (a) and line 2 (b) was measured by ELISA. PDL cell line 1 was incubated for 24–48 hrs without stress in 15 mL of fresh medium for the measurement of IL-8 mRNA levels by real-time PCR (a, bottom panel). Vertical bars indicate mean ± SD (n = 3). *Indicates significant (p < 0.05) difference as compared with untreated cells, calculated by t test.

 

Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
Figure 2. Effect of pressure force on chemokine mRNA and protein expression by PDL. (A) Two lines of PDL cells (lines 1 and 2) were stimulated by centrifugation (10 g/cm2, 20 min) and incubated for 1.5–6.5 hrs in 15 mL of fresh medium ({alpha}-MEM supplemented with 10% FBS) for total RNA collection. IL-8, MIP-1{alpha}, and RANTES mRNA levels were quantified by real-time PCR. (B) PDL cells (lines 1 and 2) were stimulated by centrifugation (10 g/cm2, 20 min), and the IL-8 concentration in culture media was measured by ELISA (a, line 1; b, line 2). Vertical bars indicate mean ± SD (n = 3). *Indicates significant (p < 0.05) difference as compared with untreated cells, calculated by t test.

 
IL-8 protein concentrations in culture supernatants gradually increased without stimulation (Figs. 1BGo, 2BGo), which is consistent with the constitutive low-level IL-8 mRNA expression in PDL cells (Figs. 1Aa, 1BaGo, bottom panels). With pulsating fluid flow and centrifugation treatments, IL-8 concentrations were significantly higher than in unstimulated control samples at 24 and 48 hrs. The concentrations of MIP-1{alpha} and RANTES were below detection levels at any time-point (data not shown).

IL-8 Secretion in Orthodontic Tooth Movement
To explore IL-8 secretion by clinical orthodontic force, we moved the maxillary canines of 10 healthy individuals in a mesial direction by means of elastic bands. There were no statistically significant differences in the probing depth, gingival index, and GCF volume. We determined the total IL-8 content in each GCF sample by multiplying IL-8 concentration by GCF volume. Various amounts (from 20 to 65 pg) of IL-8 were detected in the GCF of each participant at day 0 (Fig. 3Go). In nine out of ten participants, total IL-8 in GCF increased within 2–4 days after load application (Fig. 3Go).


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
Figure 3. IL-8 amounts in GCF samples of individuals with orthodontic force application. GCF was sampled from the mesial gingival crevice of each experimental maxillary canine at indicated times before and after the application of elastic modules. The concentration of IL-8 in GCF was measured by ELISA as described in MATERIALS & METHODS.

 
Involvement of IL-1β in Mechanical Stimuli-induced IL-8 Expression in PDL Cells
To assess the role of IL-1β, we first analyzed IL-1β gene expression in 2 PDL cell lines in response to mechanical stimuli by real-time PCR. The PDL cells constitutively expressed a low-level IL-1β mRNA, but stimulation with either shear stress or pressure force did not increase IL-1β mRNA (Fig. 4AGo). In contrast, IL-1β mRNA was decreased moderately but significantly in both PDL cell lines by shear stress, and in 1 PDL cell line by pressure force. We then pre-treated PDL cells with a neutralizing anti-IL-1β antibody, and analyzed IL-8 mRNA induction by mechanical stimuli. Neutralization of IL-1β abrogated the inducible expression of IL-8 mRNA (Fig. 4BGo).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
Figure 4. Involvement of IL-1β and MAPK activation in the IL-8 expression by PDL cells. (A) Two lines of PDL cells (lines 1 and 2) were stimulated by pulsating fluid flow (a) or centrifugal force (b), then incubated for 1.5–6.5 hrs in fresh medium for total RNA collection. IL-1β mRNA levels were quantified by real-time PCR. Vertical bars indicate mean ± SD (n = 3). *Indicates significant (p < 0.05) difference as compared with untreated cells, calculated by t test. (B) PDL cells (line 1) were incubated in medium supplemented with anti-IL-1β (5 ng/mL) or the control antibody (5 ng/mL) for 0.5 hr before stimulation. After stimulation with pulsating fluid flow (a) or centrifugation (b), PDL cells were incubated for 3.5 hrs (a) or 4.5 hrs (b). IL-8 mRNA levels were quantified by real-time PCR. Vertical bars indicate mean ± SD (n = 3). *Indicates a significant difference (p < 0.05), by t test. (C) Roles of p38 kinase, JNK, ERK, and NF-{kappa}B on IL-8 expression by PDL cells. PDL cells (line 1) were pre-incubated with various concentrations of each indicated inhibitor for 0.5 hr before stimulation. As the negative control, DMSO was added to the medium. The cells were then stimulated by a pressure centrifugal force, followed by the 4.5-hour incubation in medium before total RNA collection. IL-8 mRNA levels were quantified by real-time PCR, as described in MATERIALS & METHODS. Vertical bars indicate mean ± SD (n = 3). *Indicates a significant difference (p < 0.05), by t test. (D) Effects of specific inhibitors on activated signaling molecules. PDL cells (line 1) were pre-incubated with each indicated inhibitor for 0.5 hr before stimulation. As the negative control, DMSO was added to the medium. The cells were collected immediately after stimulation by a pressure centrifugal force. Cell lysates were analyzed by Western blotting.

 
IL-8 Induction by Pressure Force is Dependent on MAP Kinase But Not NF-{kappa}B Activation
To analyze the downstream signals of the mechanical stimuli leading to IL-8 induction, we pre-treated PDL cells with a specific inhibitor of p38 kinase, JNK, ERK, or NF-{kappa}B. Specific inhibitors of p38 kinase, JNK, and ERK significantly inhibited IL-8 mRNA induction dose-dependently with pressure force (Fig. 4CGo). We confirmed that the 3 MAP kinase inhibitors successfully inhibited the phosphorylation of each target kinase induced by pressure (Fig. 4DGo). In contrast, pressure did not reduce the cytoplasmic content of I{kappa}B (Fig. 4DGo), and a specific NF-{kappa}B inhibitor showed no inhibitory effect (Fig. 4CGo).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
One of the first reactions to an orthodontic load is the stress-strain alterations within the PDL. In the classic model, compressive stimulus on the roots along the movement direction induces bone resorption, while tension on the other side leads to bone formation (Davidovitch, 1991). When the tooth is loaded, PDL cells are also exposed to fluid shear stress, due to the visco-elastic properties of the PDL (Ferrier and Dillon, 1983). PDL cells also respond to IL-1β (Long et al., 2001) and LPS (Yamaji et al., 1995) by expressing IL-8, and the GCF of persons with periodontal disease contains higher levels of IL-8 and RANTES (Gamonal et al., 2000), indicating that PDL cells are the source of chemokines under certain conditions. The detailed chemokine expression profile of PDL cells by mechanical stress, however, has not been elucidated.

Here, we demonstrated that PDL cells constitutively expressed mRNAs for IL-8, MIP-1{alpha}, and RANTES, but not MCP-1. Among these chemokines, IL-8 mRNA markedly increased after shear stress and pressure treatments. The fold induction of IL-8 protein was much less than the peak induction of IL-8 mRNA (Figs. 1Aa, 1BGo, 2Aa, 2BGo), presumably because IL-8 mRNA induction was only transient after the brief treatments by shear stress and pressure force. It is not likely that this expression profile was due simply to clonal variation, since all 5 PDL cell clones examined showed similar profiles (data not shown).

Pulsating fluid flow is an effective method for the application of shear stress to cells, and has been proven to induce the production of NO and PGE2 from osteocytes (Klein-Nulend et al., 1995) and endothelial cells (Buga et al., 1991). In a previous report, PDL cells, but not gingival fibroblasts, were reported to respond to pulsating fluid flow with significantly elevated NO and PGE2 release, indicating that PDL cells were more sensitive to shear stress than were gingival fibroblasts (van der Pauw et al., 2000).

We found various amounts (from 20 to 65 pg) of IL-8 in the GCFs of healthy participants. More importantly, the amounts of IL-8 in nine out of ten participants increased within 2–4 days of orthodontic force application. Thus, in orthodontic tooth movement, it is reasonable to presume that PDL-derived IL-8 recruits inflammatory cells, which produce pro-inflammatory cytokines, such as TNF-{alpha}, IL-1, and IL-6, which are known to induce osteoclast differentiation, contributing to alveolar bone destruction (Kobayashi et al., 2000; van’t Hof et al., 2000). Quite recent reports, in contrast, have revealed more direct effects of IL-8 on bone resorption (Bendre et al., 2003, 2005). IL-8 stimulates RANKL expression in osteoblasts without inducing the antagonizing osteoprotegerin. More intriguingly, CXCR1 (the IL-8 receptor) has been detected on the surfaces of osteoclasts and their progenitors, indicating that IL-8 may directly stimulate osteoclastogenesis without the involvement of RANKL. Thus, it is possible that increased IL-8 secretion from PDL cells by orthodontic load may directly activate local osteoclastogenesis.

The abrogation of IL-8 induction by neutralizing IL-1β indicated an essential role of IL-1β in mechano-stress-mediated IL-8 expression. Interestingly, however, under our experimental conditions, IL-1β mRNA in PDL cells was not increased by either shear stress or pressure force. Thus, the constitutive low-level expression of IL-1β appears sufficient for IL-8 expression to be responsive to mechanical stimuli. Previous reports indicated that IL-1β production by PDL cells is increased by mechanical strain of high magnitude (Shimizu et al., 1994), whereas equi-biaxial tensile stain of low magnitude inhibits IL-1β production by PDL cells (Long et al., 2001). Thus, mechanical forces may affect IL-1β production by PDL cells in a rather complex manner, depending on the nature and magnitude of the loads. Additionally, MCP-1 mRNA was undetectable in our experimental system, whereas MCP-1 mRNA was reported to be promoted by IL-1β in human PDL cells (Ozaki et al., 1996). This may indicate that the endogenous low-level expression of IL-1β is not sufficient to induce MCP-1 gene expression.

Our results indicated that IL-8 induction in PDL cells required the concomitant presence of 2 signals: one from IL-1β, and the other directly from the mechanical stimulus. IL-8 expression is regulated primarily at the transcriptional level, and its promoter contains functional binding sites for NF-{kappa}B, C/EBP, and AP-1 (Mukaida et al., 1990; Yasumoto et al., 1992). IL-1β activates ERKs and p38 in various cell types (Fan et al., 2001; Suzuki et al., 2001), and induces IL-8 gene expression through AP-1 and NF-{kappa}B in human vascular smooth-muscle cells (Jung et al., 2002). In contrast, downstream signals of many mechanical stimuli have not been well-described. A report analyzing human airway smooth-muscle cells indicated that mechanical stretch increased IL-8 transcription through AP-1 and C/EBP via ERK and p38 kinase activations (Mukaida, 2000). In the present study, we found that pressure force rapidly activated ERK, JNK, and p38, but not the NF-{kappa}B pathway. Consistently, pressure-induced IL-8 expression was inhibited by specific inhibitors for ERK, JNK, and p38 kinase, but not by that for MG-132, indicating that PDL cells require activation of the 3 MAP kinases, but not NF-{kappa}B, for pressure-induced IL-8 expression.

It should be noted, however, that cell types other than PDL cells may contribute to local IL-8 expression, since IL-8 can be produced by various kinds of cells, including monocytes, epithelial cells, fibroblasts, and endothelial cells. The most likely candidate is gingival fibroblasts, since they have been previously reported to produce IL-8 in response to IL-1β (Yucel-Lindberg and Brunius, 2006).

In summary, we demonstrated that IL-8 is preferably induced by shear stress and pressure force in human PDL cells. Increased IL-8 levels in GCF during orthodontic tooth movement indicated that local IL-8 expression is evident in response to clinical orthodontic loads. Since IL-8 seems to activate osteoclastogenesis through various mechanisms, mechano-stress-induced IL-8 from PDL cells may play an essential role in efficient orthodontic tooth movement.


    ACKNOWLEDGMENTS
 
This study was supported by Grants-in-aid for Scientific Research (B) for T.M. and Encouragement of Scientists (B) for K.S. from the Japan Society for the Promotion of Science.

Received for publication February 13, 2006. Revision received January 17, 2007. Accepted for publication February 8, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Alhashimi N, Frithiof L, Brudvik P, Bakhiet M (1999). Chemokines are upregulated during orthodontic tooth movement. J Interferon Cytokine Res 19:1047–1052.[Medline] [Order article via Infotrieve]
  • Bakker AD, Soejima K, Klein-Nulend J, Burger EH (2001). The production of nitric oxide and prostaglandin E(2) by primary bone cells is shear stress dependent. J Biomech 34:671–677.[CrossRef][Medline] [Order article via Infotrieve]
  • Bendre MS, Montague DC, Peery T, Akel NS, Gaddy D, Suva LJ (2003). Interleukin-8 stimulation of osteoclastogenesis and bone resorption is a mechanism for the increased osteolysis of metastatic bone disease. Bone 33:28–37.
  • Bendre MS, Margulies AG, Walser B, Akel NS, Bhattacharrya S, Skinner RA, et al. (2005). Tumor-derived interleukin-8 stimulates osteolysis independent of the receptor activator of nuclear factor-kappaB ligand pathway. Cancer Res 65:11001–11009.[Abstract/Free Full Text]
  • Buga GM, Gold ME, Fukuto JM, Ignarro LJ (1991). Shear stress-induced release of nitric oxide from endothelial cells grown on beads. Hypertension 17:187–193.[Abstract/Free Full Text]
  • Davidovitch Z (1991). Tooth movement. Crit Rev Oral Biol Med 2:411–450.[Abstract/Free Full Text]
  • Fan XM, Wong BC, Lin MC, Cho CH, Wang WP, Kung HF, et al. (2001). Interleukin-1beta induces cyclo-oxygenase-2 expression in gastric cancer cells by the p38 and p44/42 mitogen-activated protein kinase signaling pathways. J Gastroenterol Hepatol 16:1098–1104.[CrossRef][Medline] [Order article via Infotrieve]
  • Ferrier JM, Dillon EM (1983). The water binding capacity of the periodontal ligament and its role in mechanical function. J Periodontal Res 18:469–473.[Medline] [Order article via Infotrieve]
  • Gamonal J, Acevedo A, Bascones A, Jorge O, Silva A (2000). Levels of interleukin-1 beta, -8, and -10 and RANTES in gingival crevicular fluid and cell populations in adult periodontitis patients and the effect of periodontal treatment. J Periodontol 71:1535–1545.[CrossRef][Medline] [Order article via Infotrieve]
  • Jung YD, Fan F, McConkey DJ, Jean ME, Liu W, Reinmuth N, et al. (2002). Role of P38 MAPK, AP-1, and NF-kappaB in interleukin-1beta-induced IL-8 expression in human vascular smooth muscle cells. Cytokine 18:206–213.[CrossRef][Medline] [Order article via Infotrieve]
  • Kakimoto K, Machigashira M, Ohnishi T, Kajihara T, Semba I, Setoguchi T, et al. (2002). Hepatocyte growth factor in gingival crevicular fluid and the distribution of hepatocyte growth factor-activator in gingival tissue from adult periodontitis. Arch Oral Biol 47:655–663.[CrossRef][Medline] [Order article via Infotrieve]
  • Klein-Nulend J, van der Plas A, Semeins CM, Ajubi NE, Frangos JA, Nijweide PJ, et al. (1995). Sensitivity of osteocytes to biomechanical stress in vitro. FASEB J 9:441–445.[Abstract/Free Full Text]
  • Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, et al. (2000). Tumor necrosis factor alpha stimulates osteoclast differentiation by a mechanism independent of the ODF/RANKL-RANK interaction. J Exp Med 191:275–286.[Abstract/Free Full Text]
  • Long P, Hu J, Piesco N, Buckley M, Agarwal S (2001). Low magnitude of tensile strain inhibits IL-1beta-dependent induction of pro-inflammatory cytokines and induces synthesis of IL-10 in human periodontal ligament cells in vitro. J Dent Res 80:1416–1420.
  • Lowney JJ, Norton LA, Shafer DM, Rossomando EF (1995). Orthodontic forces increase tumor necrosis factor alpha in the human gingival sulcus. Am J Orthod Dentofacial Orthop 108:519–524.[CrossRef][Medline] [Order article via Infotrieve]
  • Matsuguchi T, Masuda A, Sugimoto K, Nagai Y, Yoshikai Y (2003). JNK-interacting protein 3 associates with Toll-like receptor 4 and is involved in LPS-mediated JNK activation. EMBO J 22:4455–4464.[CrossRef][Medline] [Order article via Infotrieve]
  • Mukaida N (2000). Interleukin-8: an expanding universe beyond neutrophil chemotaxis and activation. Int J Hematol 72:391–398.[Medline] [Order article via Infotrieve]
  • Mukaida N, Mahe Y, Matsushima K (1990). Cooperative interaction of nuclear factor-kappa B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines. J Biol Chem 265:21128–21133.[Abstract/Free Full Text]
  • Ozaki K, Hanazawa S, Takeshita A, Chen Y, Watanabe A, Nishida K, et al. (1996). Interleukin-1 beta and tumor necrosis factor-alpha stimulate synergistically the expression of monocyte chemoattractant protein-1 in fibroblastic cells derived from human periodontal ligament. Oral Microbiol Immunol 11:109–114.[Medline] [Order article via Infotrieve]
  • Redlich M, Asher Roos H, Reichenberg E, Zaks B, Mussig D, Baumert U, et al. (2004). Expression of tropoelastin in human periodontal ligament fibroblasts after simulation of orthodontic force. Arch Oral Biol 49:119–124.[Medline] [Order article via Infotrieve]
  • Shimizu N, Yamaguchi M, Goseki T, Ozawa Y, Saito K, Takiguchi H, et al. (1994). Cyclic-tension force stimulates interleukin-1 beta production by human periodontal ligament cells. J Periodontal Res 29:328–333.[CrossRef][Medline] [Order article via Infotrieve]
  • Shimizu N, Ozawa Y, Yamaguchi M, Goseki T, Ohzeki K, Abiko Y (1998). Induction of COX-2 expression by mechanical tension force in human periodontal ligament cells. J Periodontol 69:670–677.[Medline] [Order article via Infotrieve]
  • Suzuki K, Hino M, Kutsuna H, Hato F, Sakamoto C, Takahashi T, et al. (2001). Selective activation of p38 mitogen-activated protein kinase cascade in human neutrophils stimulated by IL-1beta. J Immunol 167:5940–5947.[Abstract/Free Full Text]
  • Uematsu S, Mogi M, Deguchi T (1996). Interleukin (IL)-1 beta, IL-6, tumor necrosis factor-alpha, epidermal growth factor, and beta 2-microglobulin levels are elevated in gingival crevicular fluid during human orthodontic tooth movement. J Dent Res 75:562–567.
  • van der Pauw MT, Klein-Nulend J, van den Bos T, Burger EH, Everts V, Beertsen W (2000). Response of periodontal ligament fibroblasts and gingival fibroblasts to pulsating fluid flow: nitric oxide and prostaglandin E2 release and expression of tissue non-specific alkaline phosphatase activity. J Periodontal Res 35:335–343.[CrossRef][Medline] [Order article via Infotrieve]
  • van’t Hof RJ, Armour KJ, Smith LM, Armour KE, Wei XQ, Liew FY, et al. (2000). Requirement of the inducible nitric oxide synthase pathway for IL-1-induced osteoclastic bone resorption. Proc Natl Acad Sci USA 97:7993–7998.[Abstract/Free Full Text]
  • Yamaji Y, Kubota T, Sasaguri K, Sato S, Suzuki Y, Kumada H, et al. (1995). Inflammatory cytokine gene expression in human periodontal ligament fibroblasts stimulated with bacterial lipopolysaccharides. Infect Immun 63:3576–3581.[Abstract]
  • Yasumoto K, Okamoto S, Mukaida N, Murakami S, Mai M, Matsushima K (1992). Tumor necrosis factor alpha and interferon gamma synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-kB-like binding sites of the interleukin 8 gene. J Biol Chem 267:22506–22511.[Abstract/Free Full Text]
  • Yucel-Lindberg T, Brunius G (2006). Epidermal growth factor synergistically enhances interleukin-8 production in human gingival fibroblasts stimulated with interleukin-1beta. Arch Oral Biol 51:892–898.[Medline] [Order article via Infotrieve]

Journal of Dental Research, Vol. 86, No. 7, 629-634 (2007)
DOI: 10.1177/154405910708600709


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JDRHome page
I. Andrade Jr., S.R.A. Taddei, G.P. Garlet, T.P. Garlet, A.L. Teixeira, T.A. Silva, and M.M. Teixeira
CCR5 Down-regulates Osteoclast Function in Orthodontic Tooth Movement
Journal of Dental Research, November 1, 2009; 88(11): 1037 - 1041.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
V. Krishnan and Z. Davidovitch
On a Path to Unfolding the Biological Mechanisms of Orthodontic Tooth Movement
Journal of Dental Research, July 1, 2009; 88(7): 597 - 608.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Maeda, A.
Right arrow Articles by Matsuguchi, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maeda, A.
Right arrow Articles by Matsuguchi, T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?