Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

CiteULike is a free service for managing and discovering scholarly references - click here to get started.

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Gibson, C.W.
Right arrow Articles by Wright, J.T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gibson, C.W.
Right arrow Articles by Wright, J.T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Transgenic Mice that Express Normal and Mutated Amelogenins

C.W. Gibson1,*, Z.A. Yuan1, Y. Li1, B. Daly2, C. Suggs2, M.A. Aragon1, F. Alawi3, A.B. Kulkarni4 and J.T. Wright2

1 Dept. of Anatomy and Cell Biology and
3 Dept. of Pathology, School of Dental Medicine, University of Pennsylvania, 240 S. 40th Street, Philadelphia, PA 19104-6030, USA
2 Dept. of Pediatric Dentistry, School of Dentistry, University of North Carolina, Chapel Hill, NC 27599, USA; and
4 Functional Genomics Section, National Institute of Dental and Craniofacial Research, NIH, Bethesda, MD 20892, USA

Correspondence: * corresponding author, gibson{at}biochem.dental.upenn.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Amelogenin proteins are secreted by ameloblasts within the enamel organ during tooth development. To better understand the function of the 180-amino-acid amelogenin (M180), and to test the hypothesis that a single proline-to-threonine (P70T) change would lead to an enamel defect similar to amelogenesis imperfecta (AI) in humans, we generated transgenic mice with expression of M180, or M180 with the proline-to-threonine (P70T) mutation, under control of the Amelx gene regulatory regions. M180 teeth had a relatively normal phenotype; however, P70T mineral was abnormally porous, with aprismatic regions similar to those in enamel of male amelogenesis imperfecta patients with an identical mutation. When Amelx null females were mated with P70T transgenic males, offspring developed structures similar to calcifying epithelial odontogenic tumors in humans. The phenotype argues for dominant-negative activity for the P70T amelogenin, and for the robust nature of the process of amelogenesis.

Key Words: dental enamel • amelogenin • transgenic mice • odontogenic tumor


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The amelogenin proteins are the most abundant secretory products of ameloblasts and comprise approximately 90% of the extracellular matrix early in dental enamel development (Termine et al., 1980). These evolutionarily conserved enamel proteins assemble and guide growth of enamel crystals, and are necessary for the full thickness of enamel to form (Gibson et al., 2001). Mutations in the human X-chromosomal amelogenin (AMELX) gene or other enamel genes lead to enamel defects known collectively as amelogenesis imperfecta.

Amelogenesis imperfecta has been classified in several systems, according to phenotypic appearance, by genetic inheritance pattern, and by the nature of the mutation itself, when known. The phenotype of X-linked amelogenesis imperfecta varies, because different AMELX mutations produce N- or C-terminal protein changes, resulting in altered function and creating differences in enamel appearance (Snead, 2003; Wright et al., 2003). Additionally, an X-linked amelogenesis-imperfecta-associated gene locus has been identified on the Xq region of the chromosome (Aldred et al., 1992). There is also an active human amelogenin gene on the Y chromosome, but AMELY mutations resulting in AI have not yet been reported, and indeed deletion of this gene appears not to result in an enamel phenotype in males (Lattanzi et al., 2005).

During enamel development, extensive alternative splicing of the amelogenin primary transcript leads to as many as 15 individual messages (Hu et al., 1997; Papagerakis et al., 2005; Li et al., 2006). The translated amelogenins are progressively hydrolyzed by enamel proteases as enamel crystals grow (Smith, 1998). This process is carefully orchestrated to lead to an extremely intricate and highly organized enamel layer with less than 2% organic matrix by the time a tooth erupts into the oral cavity (Robinson et al., 1998; Fincham et al., 1999).

Because of the complexity of the process, leading to a large number of amelogenin proteins as well as their degradation products, which may take on unique functions as well, it has been difficult to assign functions to individual amelogenins. Hypotheses about why so many amelogenins are produced and whether they have subtle differences in function are being addressed by investigators expressing the proteins and studying assembly in vitro, or by generatiing null animal models, or mice that express a single amelogenin, to evaluate function in vivo (Moradian-Oldak et al., 2000; Gibson et al., 2001; Chen et al., 2003; Zhu et al., 2006).

To understand the role of the most abundant amelogenin, M180, during enamel development, and whether an M180 point mutation will lead to an enamel defect, we describe here the generation, molecular analysis, and phenotype of transgenic mice that express M180 under the control of Amelx regulatory sequences. We generated additional transgenic lines with the P70T mutation in M180, as described in humans with amelogenesis imperfecta (Collier et al., 1997), to determine the morphological effects of the single amino acid change in transgenic mice with the full complement of endogenous amelogenin proteins.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Construction
We constructed the M180 expression vector by inserting bovine genomic DNA, which included 5.5 kb of the upstream AmelX region, exon 1, and intron 1 to the PpuMI site in exon 2 (Gibson et al., 1991) into pSP72 (Promega Biosciences, San Luis Obispo, CA, USA). This gene fragment was ligated to the PpuM1 site in bovine cDNA, encoding the rest of exon 2 through the KpnI site in exon 5 (Gibson et al., 1991). A murine cDNA fragment from the KpnI site in exon 5, including the rest of exon 5 and exon 6 to the HindIII site, was subcloned adjacent to this region, followed by bovine cDNA from the HindIII site to the end of the coding sequence, and 500 bp of AmelX 3' genomic DNA, which included the polyadenylation signal sequence and an engineered EcoR1 site used for subcloning (Fig. 1Go). All junctions were confirmed by DNA sequence analysis.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Figure 1. Map of the expression vector for M180 and the modification for the P70T vector used for the generation of transgenic mice. Vector includes 5.5-kb Amelx upstream region, exon 1, intron 1, exons 2, 3, 5, 6, 7, and 3' genomic DNA. Location of the P70T mutation is indicated. UTR: untranslated region.

 
The designation ’P70T’ is the result of the revised numbering system (Hart et al., 2002); the previous designation was ’p41’ (Collier et al., 1997). The P70T expression vector was generated by mutagenesis of a subclone containing exons 5, 6, and 7 from the M180 vector described above, with use of the Quick Change ll Site-directed Mutagenesis kit (Stratagene, La Jolla, CA, USA). The mutagenesis primers included a single DNA difference (bold) to alter proline to threonine in exon 6, at amino acid 70:

5' primer:

CCTTCCTATGGTTACGAAACCATGGGTGGATGGCTGCACC

3' primer:

GGTGCAGCCATCCACCCATGGTTTCGTAACCATAGGAAGG

This change was confirmed by DNA sequence analysis, and then the subclone was reinserted to replace this region in the expression vector.

Generation of Transgenic Mice and Molecular Analysis
The complete inserts from each plasmid were released by XhoI digestion and injected into fertilized mouse eggs at the University of Pennsylvania Transgenic Core Facility. Work involving mice was done in an AAALAC-accredited facility, and protocols were approved by the IACUC of the University of Pennsylvania.

DNA was purified from mouse tails and subjected to PCR as previously described (Chen et al., 2003), for the identification of transgenic mice. RNA was isolated from mandibular teeth from 3-to 5-day-old pups and subjected to RT-PCR as previously described (Chen et al., 2003). For protein analysis, male transgenic mice were mated with AmelX null females, and M1 molar teeth were dissected from transgene-positive or transgene-negative offspring at 3–5 days of age. Extracts were prepared as previously described (Chen et al., 2003); samples were subjected to gradient gel electrophoresis and transferred to nitrocellulose (BioRad Laboratories, Hercules, CA, USA). Western blots were probed with an anti-amelogenin C-terminus antibody (Gibson et al., 1995). Secondary antibody was visualized with DAB Peroxidase Substrate (Sigma, St. Louis, MO, USA).

Microscopic Analysis of Murine Teeth
Mandibles were fixed in 4% paraformaldehyde overnight, and gross inspection of mandibular molar and incisor surfaces was done by light microscopy. For histological examination of the ameloblasts and developing dental tissues, the mandibles were decalcified, embedded in paraffin, sectioned with identical transverse orientation (so that specific developmental stages could be established), and stained with hematoxylin and eosin. Images of sections were recorded for incisors and molars. For immunohistochemistry, paraffin sections were incubated with anti-amelogenin antibody, and negative controls lacked primary antibody. Scanning electron micrographic analysis of tooth surfaces and fractured internal enamel and dentin surfaces of incisors and molars was completed at 20 kV (Jeol JSM T330A, Jeol, Inc., Peabody, MA, USA).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
M180 Expression Vector
This expression vector was adapted from vectors used previously to express β-galactosidase or other amelogenin proteins in ameloblasts (Chen et al., 1994, 2003). The vector included 5.5 kb of bovine AmelX upstream genomic sequence, bovine AmelX untranslated exon 1 and intron 1, and exons from either bovine or murine cDNA (Fig. 1Go). The DNA sequence varied sufficiently for specific PCR primer analysis; however, only 3 amino acids differed from those in the mouse, due to the bovine sequence, at #16S>A in the signal sequence, and #25H>S and #31 F>L in exon 3. These substitutions were not in highly conserved regions (Delgado et al., 2006).

Site-directed Mutagenesis to Generate the P70T Transgene
A 3.5-kB fragment containing exon 6 was subjected to in vitro mutagenesis with a primer that changed amino acid 70 from a proline to a threonine (Fig. 1Go). All other amino acids were identical in these 2 transgenes.

Generation and Molecular Analysis of Transgenic Mice
Injection of the inserts from the 2 plasmids into fertilized mouse eggs led to the generation of several founders with germline transmission. Strains were monitored by PCR of tail DNA; primers for PCR were designed to unique regions of the transgene, as described previously (Chen et al., 2003; not shown).

Strains generated and transgene copy numbers for the F1 heterozygotes are listed in the APPENDIX Table. First mandibular molar teeth were dissected from 3- to 5-day-old pups, and RNA was purified and analyzed by reverse-transcriptase/polymerase chain-reaction (RT-PCR) for the expression of the transgenes. Unique primers were designed to recognize the transgene, but not the RNA products of the endogenous AmelX gene (APPENDIX Fig.); products were not observed with wild-type control teeth.

To detect expression of the transgenic protein, we mated male transgenic mice to female AmelX null mice, which did not express any of the amelogenin proteins (Gibson et al., 2001). Following PCR analysis of tail DNA, we made extracts from developing teeth of male offspring that were positive or negative for the transgene. Because the AmelX gene is solely on the X chromosome in mice, all males from this mating would have a null genetic background, to eliminate the endogenous amelogenins in the Western blot. Proteins were separated by electrophoresis on an agarose gel and transferred to nitrocellulose for Western blotting. An antibody that recognizes amelogenin C-terminus (Gibson et al., 1995) was used to detect expression (Fig. 2Go). Heterozygous females were the positive controls.


Figure 2
View larger version (52K):
[in this window]
[in a new window]

 
Figure 2. Western blot of extracts from Amelx null/M180, Amelx null/P70T, and Amelx null first molars. Anti-amelogenin antibody was used to detect amelogenin protein. Lanes: KOxM180-31, KOxP70T-2, or KOxP70T-16 indicates female null and male transgenic parents. M– is null male without transgene; M+ is null male with transgene. F– and F+ are heterozygous females without and with the transgene, respectively.

 
Phenotypic Analysis of Transgenic Mouse Teeth
Molars from both of the M180 transgenic mouse lines (Fig. 3BGo) were grossly similar to wild-type teeth (Fig. 3AGo). Molars of the P70T mice had marked attrition of the cusps and a highly irregular chalky appearance (Fig. 3CGo).


Figure 3
View larger version (151K):
[in this window]
[in a new window]

 
Figure 3. Phenotype of wild-type, M180, and P70T molars (wild-type background). Light microscopic view of molars from wild-type (A), M180 transgenic (B), and P70T transgenic mice (C). Scanning electron micrographs of M180 (D) and P70T (E,F) molar enamel.

 
Scanning electron micrographic analysis of molar enamel indicated a prismatic nature for wild-type (not shown) and M180 teeth (Fig. 3DGo). Molars from P70T mice had aprismatic regions in the enamel, with porosity and the appearance of plate-like crystallites intermixed with the prismatic areas (Figs. 3E, 3FGo). These areas appeared to be more prevalent in the male animals compared with females, and were similar to the appearance of human AI enamel with the same mutation (Ravassipour et al., 2000).

Tumor Phenotype
When P70T transgenic males were mated with Amelx null females, offspring that were transgene-positive had a more severe enamel phenotype compared with that of Amelx null or P70T transgenic mice. Histological analysis revealed a hyperplastic stratum intermedium cell layer exhibiting transition to a tumor composed of benign, eosinophilic, polygonal cells with intercellular bridges. The proliferative cells were generally arranged in variably sized cords, with aggregates of amorphous, basophilic-staining material in direct apposition to the proliferating stratum intermedium cells (Fig. 4AGo), some of which were identified, by immunohistochemistry, as amelogenin-positive (Fig. 4CGo). Although calcification was not obvious in these tumors by microCT scanning, further analysis will be needed to clarify this question. These abnormal cells were not seen in Amelx null or other Amelx transgenic strains (Fig. 4BGo), and were apparent by 4–5 days of age.


Figure 4
View larger version (91K):
[in this window]
[in a new window]

 
Figure 4. (AQ) Histology of a normal developing tooth and an odontogenic tumor (Amelx heterozygous background). (A) Amelx +/–/P70T with tumor; (B) Amelx +/–/M180; and (C) Amelx –/0/P70T immunohistochemistry using anti-amelogenin antibody.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Overexpression of a normal amelogenin such as M180 does not greatly alter enamel structure, indicating the robust nature of amelogenesis. Similar results have been reported for mice that overexpress LRAP, a 59-amino-acid amelogenin (Chen et al., 2003), and TRAP, the N-terminus of amelogenin (Paine et al., 2004).

We had hypothesized that a single amino acid difference in the transgene would lead to an enamel defect similar to that seen in human AI with the same mutation, and indeed this was the result. In the P70T transgenic mice, all normal amelogenins are expressed, in addition to the mutated transgene. In humans, by contrast, the mutation resides in the endogenous gene, and all amelogenin proteins that include this region of exon 6 will have the mutation. Human males also have a Y-chromosomal amelogenin gene (Salido et al., 1992), which is thought to be expressed at a level that is too low to provide rescue of the phenotype. Human females have 2 X chromosomes, and in cases with an AMELX mutation, one of them would have a normal AMELX gene, leading to Lyonization, where vertical ridges of normal and defective enamel interdigitate (Sauk et al., 1972; Collier et al., 1997).

The observation that the P70T transgene generated an enamel defect reveals the dominant nature of this mutation. This region of the amelogenin protein has received much attention, since it is a region capable of binding N-acetyl glucosamine, a sugar that could be on other enamel proteins, leading to specific interactions (Ravindranath et al., 1999). P70T is also adjacent to a proteolytic cleavage site thought to be required for orderly removal of the protein during mineral crystal growth, and this mutation reduces enzyme activity in vitro (Fincham et al., 1983; Li et al., 2001).

While the actual mechanism(s) whereby this mutation leads to amelogenesis imperfecta has not yet been ascertained, this study points to yet another function related to cell binding or proliferation. Odontogenic tumors have not been observed in the Amelx null mice or in Amelx null/M180 mice, but the Amelx/P70T mice develop abnormal proliferations at an early age and with high penetrance (10/10 in 2 strains), beginning at 4–5 days of age.

Abnormal cell structures are observed as early as 1 day of age adjacent to incisors, and tumors form adjacent to both incisors and molars in both Amelx null/P70T males and heterozygous Amelx +/–/P70T females. Because the enamel phenotype is much more severe in molars than incisors of transgenic mice, we hypothesize that expression of the transgene could be greater in molars than incisors. However, P70T expression leads to abnormal stratum intermedium proliferation, even in Amelx het females, which would be secreting half the normal amount of amelogenin proteins. Therefore, tumor formation appears to require only a small amount of P70T to be present, linked to a reduction of normal amelogenins.

Collectively, the histologic findings were highly reminiscent of those seen in calcifying epithelial odontogenic tumors, which are rare, benign epithelial odontogenic tumors that are thought to be derived from stratum intermedium cells. The tumor is characterized by intercellular linkages that are apparent between both normal stratum intermedium and tumor cells, and these structures are visible in both human and murine tumors. Cells related to ameloblasts are within the tumors, which immunochemistry reveals to be amelogenin-positive. Tumors have not as yet been reported in humans with the P70T mutation, and therefore, insight into the reason behind this potential difference may lead to a greater understanding of stratum intermedium biology.

Mice that are null for ameloblastin, an unrelated enamel protein, also develop odontogenic tumors, but in this case, 19% of mice developed ameloblast proliferations beginning at 28 wks of age (Fukumoto et al., 2004, 2005). In this case, the mechanism was suggested to be a loss of ameloblast attachment to the enamel surface, leading to inappropriate proliferation.

In conclusion, the murine models described here illustrate the robust nature of amelogenesis, since enamel tolerates excess normal amelogenins well. The P70T mutation reveals a role in both enamel structure as well as cell biology of the ameloblast/stratum intermedium cell layers during enamel development.


    ACKNOWLEDGMENTS
 
Transgenic lines were generated by the University of Pennsylvania Transgenic Core Facility. We acknowledge excellent animal care by the technical staff, thank J. Simmer for the anti-amelogenin antibody, and thank S. Labadessa for technical assistance. Support for this work was provided by NIDCR grant DE11089 (CWG), and by the Division of Intramural Research, NIDCR (ABK).


    FOOTNOTES
 
A supplemental appendix to this article is published electronically only at http://www.dentalresearch.org.

Received for publication August 25, 2006. Revision received November 28, 2006. Accepted for publication November 30, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Aldred MJ, Crawford PJ, Roberts E, Gillespie CM, Thomas NST, Fenton I, et al. (1992). Genetic heterogeneity in X-linked amelogenesis imperfecta. Genomics 14:567–573.[CrossRef][Medline] [Order article via Infotrieve]
  • Chen E, Piddington R, Decker S, Park J, Yuan ZA, Abrams WR, et al. (1994). Regulation of amelogenin gene expression during tooth development. Dev Dyn 199:189–198.[Medline] [Order article via Infotrieve]
  • Chen E, Yuan ZA, Wright JT, Hong SP, Li Y, Collier PM, et al. (2003). The small bovine amelogenin LRAP fails to rescue the amelogenin null phenotype. Calcif Tissue Int 73:487–495.[CrossRef][Medline] [Order article via Infotrieve]
  • Collier PM, Sauk JJ, Rosenbloom SJ, Yuan ZA, Gibson CW (1997). An amelogenin gene defect associated with human X-linked amelogenesis imperfecta. Arch Oral Biol 42:235–242.[CrossRef][Medline] [Order article via Infotrieve]
  • Delgado S, Couble ML, Magloire H, Sire JY (2006). Cloning, sequencing, and expression of the amelogenin gene in two scincid lizards. J Dent Res 85:138–143.
  • Fincham AG, Belcourt AB, Termine JD, Butler WT, Cothran WC (1983). Amelogenins. Sequence homologies in enamel-matrix proteins from three mammalian species. Biochem J 211:149–154.[Medline] [Order article via Infotrieve]
  • Fincham AG, Moradian-Oldak J, Simmer JP (1999). The structural biology of the developing dental enamel matrix. J Struct Biol 126:270–299.[CrossRef][Medline] [Order article via Infotrieve]
  • Fukumoto S, Kiba T, Hall B, Iehara N, Nakamura T, Longenecker G, et al. (2004). Ameloblastin is a cell adhesion molecule required for maintaining the differentiation state of ameloblasts. J Cell Biol 167:973–983.[Abstract/Free Full Text]
  • Fukumoto S, Yamada A, Nonaka K, Yamada Y (2005). Essential roles of ameloblastin in maintaining ameloblast differentiation and enamel formation. Cells Tissues Organs 181:189–195.[CrossRef][Medline] [Order article via Infotrieve]
  • Gibson C, Golub E, Herold R, Risser M, Ding W, Shimokawa H, et al. (1991). Structure and expression of the bovine amelogenin gene. Biochemistry 30:1075–1079.
  • Gibson CW, Kucich U, Collier P, Shen G, Decker S, Bashir M, et al. (1995). Analysis of amelogenin proteins using monospecific antibodies to defined sequences. Connect Tissue Res 32:109–114.[Medline] [Order article via Infotrieve]
  • Gibson CW, Yuan ZA, Hall B, Longenecker G, Chen E, Thyagarajan T, et al. (2001). Amelogenin-deficient mice display an amelogenesis imperfecta phenotype. J Biol Chem 276:31871–31875.[Abstract/Free Full Text]
  • Hart PS, Hart TC, Simmer JP, Wright JT (2002). A nomenclature for X-linked amelogenesis imperfecta. Arch Oral Biol 47:255–260.[CrossRef][Medline] [Order article via Infotrieve]
  • Hu CC, Ryu OH, Qian Q, Zhang CH, Simmer JP (1997). Cloning, characterization and heterologous expression of exon-4-containing amelogenin mRNAs. J Dent Res 76:641–647.
  • Lattanzi W, Di Giacomo MC, Lenato GM, Chimienti G, Voglino G, Resta N, et al. (2005). A large interstitial deletion encompassing the amelogenin gene on the short arm of the Y chromosome. Hum Genet 116:395–401.[CrossRef][Medline] [Order article via Infotrieve]
  • Li W, Gibson CW, Abrams WA, Andrews DW, DenBesten PK (2001). Reduced hydrolysis of amelogenin may result in X-linked amelogenesis imperfecta. Matrix Biol 19:755–760.[CrossRef][Medline] [Order article via Infotrieve]
  • Li Y, Yuan ZA, Aragon MA, Kulkarni AB, Gibson CW (2006). Comparison of body weight and gene expression in amelogenin null and wild-type mice. Eur J Oral Sci 114(Suppl 1):190–193.[CrossRef][Medline] [Order article via Infotrieve]
  • Moradian-Oldak J, Paine ML, Lei YP, Fincham AG, Snead ML (2000). Self-assembly properties of recombinant engineered amelogenin proteins analyzed by dynamic light scattering and atomic force microscopy. J Struct Biol 131:27–37.[CrossRef][Medline] [Order article via Infotrieve]
  • Paine ML, Zhu DH, Luo W, Snead ML (2004). Overexpression of TRAP in the enamel matrix does not alter the enamel structural hierarchy. Cells Tissues Organs 176:7–16.[CrossRef][Medline] [Order article via Infotrieve]
  • Papagerakis P, Ibarra JM, Inozentseva N, DenBesten P, MacDougall M (2005). Mouse amelogenin exons 8 and 9: sequence analysis and protein distribution. J Dent Res 84:613–617.
  • Ravassipour DB, Hart PS, Hart TX, Ritter AV, Yamauchi M, Gibson C, et al. (2000). Unique enamel phenotype associated with amelogenin gene (AMELX) codon 41 point mutation. J Dent Res 79:1476–1481.
  • Ravindranath RM, Moradian-Oldak J, Fincham AG (1999). Tyrosyl motif in amelogenins binds N-acetyl-D-glucosamine. J Biol Chem 274:2464–2471.[Abstract/Free Full Text]
  • Robinson C, Brookes SJ, Shore RC, Kirkham J (1998). The developing enamel matrix: nature and function. Eur J Oral Sci 106(Suppl 1):282–291.[Medline] [Order article via Infotrieve]
  • Salido EC, Yen PH, Koprivnikar K, Yu LC, Shapiro LJ (1992). The human enamel protein gene amelogenin is expressed from both the X and the Y chromosomes. Am J Hum Genet 50:303–316.[Medline] [Order article via Infotrieve]
  • Sauk JJ Jr, Lyon HW, Witkop CJ Jr (1972). Electron optic microanalysis of two gene products in enamel of females heterozygous for X-linked hypomaturation amelogenesis imperfecta. Am J Hum Genet 24:267–276.[Medline] [Order article via Infotrieve]
  • Smith CE (1998). Cellular and chemical events during enamel maturation. Crit Rev Oral Biol Med 9:128–161.[Abstract/Free Full Text]
  • Snead ML (2003). Amelogenin protein exhibits a modular design: implications for form and function. Connect Tissue Res 44(Suppl 1):47–51.[CrossRef][Medline] [Order article via Infotrieve]
  • Termine JD, Belcourt AB, Christner PJ, Conn KM, Nylen MU (1980). Properties of dissociatively extracted fetal tooth matrix proteins. I. Principal molecular species in developing bovine enamel. J Biol Chem 255:9760–9768.[Abstract/Free Full Text]
  • Wright JT, Hart PS, Aldred MJ, Seow K, Crawford PJ, Hong SP, et al. (2003). Relationship of phenotype and genotype in X-linked amelogenesis imperfecta. Connect Tissue Res 44(Suppl 1):72–78.[CrossRef][Medline] [Order article via Infotrieve]
  • Zhu D, Paine ML, Luo W, Bringas P Jr, Snead ML (2006). Altering biomineralization by protein design. J Biol Chem 281:21173–21182.[Abstract/Free Full Text]

Journal of Dental Research, Vol. 86, No. 4, 331-335 (2007)
DOI: 10.1177/154405910708600406


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Histochem. Cytochem.Home page
B. Ruhin-Poncet, S. Ghoul-Mazgar, D. Hotton, F. Capron, M. H. Jaafoura, G. Goubin, and A. Berdal
Msx and Dlx Homeogene Expression in Epithelial Odontogenic Tumors
J. Histochem. Cytochem., January 1, 2009; 57(1): 69 - 78.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Li, C. Suggs, J. T. Wright, Z.-a. Yuan, M. Aragon, H. Fong, D. Simmons, B. Daly, E. E. Golub, G. Harrison, et al.
Partial Rescue of the Amelogenin Null Dental Enamel Phenotype
J. Biol. Chem., May 30, 2008; 283(22): 15056 - 15062.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Gibson, C.W.
Right arrow Articles by Wright, J.T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gibson, C.W.
Right arrow Articles by Wright, J.T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?