|
Sign In to gain access to subscriptions and/or personal tools.
|
Functional TLRs and NODs in Human Gingival Fibroblasts
A. Uehara and
H. Takada*
Department of Microbiology and Immunology, Tohoku University Graduate School of Dentistry, Sendai, 980-8575, Japan
Correspondence: * corresponding author, dent-ht{at}mail.tains.tohoku.ac.jp
 |
ABSTRACT
|
|---|
Since human gingival fibroblasts are the major cells in periodontal tissues, we hypothesized that gingival fibroblasts are endowed with receptors for bacterial components, which induce innate immune responses against invading bacteria. We found clear mRNA expression of Toll-like receptors (TLR)1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, MD-2, MyD88, NOD1, and NOD2 in gingival fibroblasts. Gingival fibroblasts constitutively expressed these molecules. Upon stimulation with chemically synthesized ligands mimicking microbial products for these receptors, the production of pro-inflammatory cytokines, such as interleukin (IL)-6, IL-8, and monocyte chemoattractant protein-1, was markedly up-regulated. Furthermore, the production of pro-inflammatory cytokines induced by TLR and NOD ligands was significantly inhibited by an RNA interference assay targeted to NF- B. These findings indicate that these innate immunity-related molecules in gingival fibroblasts are functional receptors involved in inflammatory reactions in periodontal tissues, which might be responsible for periodontal pathogenesis.
Key Words: TLR NOD1 NOD2 fibroblasts innate immunity
 |
INTRODUCTION
|
|---|
In the innate immune system, pattern recognition of micro-organisms should initiate host defense against invasive pathogens, where pathogen- associated molecular patterns are recognized by the pattern recognition molecules of hosts. Representative pathogen-associated molecular patterns are distributed on bacterial cell surfaces, such as peptidoglycans, lipoproteins, and lipopolysaccharides (LPS), and intracellularly, such as specific motifs of RNA and DNA derived from viruses and bacteria. Recent studies have demonstrated that, in mammals, these pathogen-associated molecular patterns are recognized specifically by respective Toll-like receptors (TLRs). Peptidoglycans and lipoproteins are mainly recognized by TLR2, double-stranded RNA is recognized by TLR3, LPS is recognized by TLR4, single-stranded RNA is recognized by TLR7/8, and bacterial CpG DNA is recognized by TLR9 (Akira et al., 2006). More recently, it was reported that intracellular receptors for two active entities of peptidoglycans, desmuramylpeptides containing diaminopimelic acid and muramyldipeptide, were recognized by NOD1 and NOD2, respectively (Chamaillard et al., 2003; Girardin et al., 2003ab; Inohara et al., 2003).
Fibroblasts and their extracellular matrix products play pivotal roles in maintaining the structural integrity of connective tissues, in healing processes, and in pathological alterations (Buckley et al., 2001). Fibroblasts are not a homogenous population among different anatomical regions, or even within a single tissue, and are considered actively to define the structure of microenvironments and modulate immune cell behavior by conditioning the local and cellular microenvironment (Buckley et al., 2001). Human gingival fibroblasts are the major constituent of gingival connective tissue. In the initial studies on the innate immune responses of gingival fibroblasts, the cells were found to produce various inflammatory cytokines, such as interleukin (IL)-1, IL-6, and IL-8, upon stimulation with lipopolysaccharide (LPS) from periodontopathic bacteria (Takada et al., 1991; Tamura et al., 1992). Subsequently, the heterogeneous expression of CD14 by gingival fibroblasts was reported (Sugawara et al., 1998). Concerning TLR expression, gingival fibroblasts constitutively expressed TLR2 (Hatakeyama et al., 2003; Wang et al., 2003; Okusawa et al., 2004), TLR4 (Tamai et al., 2002; Hatakeyama et al., 2003; Wang et al., 2003; Okusawa et al., 2004), TLR6 (Okusawa et al., 2004), and MD-2 (Hatakeyama et al., 2003), and produced various cytokines by interaction with their ligands (Sugawara et al., 1998; Tamai et al., 2002), indicating that gingival fibroblasts actively participate in inflammatory processes and immune responses. However, NOD molecules in gingival fibroblasts have not been reported so far.
To elucidate the possible expressions of TLR1, TLR3, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2, as well as TLR2 and TLR4, in gingival fibroblasts, we examined the mRNA and protein expressions of these molecules using RT-PCR, flow cytometry, and immunostaining in vitro. Additionally, we examined whether gingival fibroblasts secreted pro-inflammatory cytokines upon stimulation with respective TLR and NOD ligands, to determine whether these pattern recognition molecules are functional. We used only chemically synthesized components, because natural microbial preparations are inevitably contaminated with minor bioactive components that might confuse the results.
 |
MATERIALS & METHODS
|
|---|
Reagents
Synthetic muramyldipeptide (MurNAc-L-Ala-C-isoGln) and an Escherichia coli-type lipid A (LA-15-PP) were purchased from the Protein Research Foundation Peptide Institute (Osaka, Japan). Polyinosinic-poly(C) [poly(I:C)] was purchased from Sigma-Aldrich (St. Louis, MO, USA). Single-stranded (ss) PolyU was purchased from Invitrogen (San Diego, CA, USA). A conventional CpG DNA, CpG DNA 1826 (TCCATGACGTTCCTGACGTT [CpG motif is underlined]), was purchased from SIGMA Genosys (Tokyo, Japan). A synthetic Mycoplasma-type diacyl lipopeptide FSL-1 (S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-[R]-cysteinyl-GDPKHPKSF) was purchased from EMC Microcollections (Tübingen, Germany). The synthetic desmuramylpeptides, a PGN fragment containing diaminopimelic acid (DAP), FK156 (D-lactoyl-L-Ala- -D-Glu-meso-DAP-Gly), was supplied by Astellas Pharmaceutical Co. (Tokyo, Japan). Anti-TLR2 (TL2.1) (mouse IgG1), anti-TLR3 (mouse IgG1), anti-TLR4 (HTA125) (mouse IgG1), anti-MD-2 (rabbit IgG), anti-TLR5 (mouse IgG1), anti-TLR6 (mouse IgG1), anti-TLR7 (rabbit IgG), anti-TLR8 (mouse IgG1), anti-TLR9 (mouse IgG1), and anti-MyD88 (rabbit IgG) antibodies were purchased from eBioscience (San Diego, CA, USA). Anti-NOD1 (goat IgG) and anti-NOD2 (goat IgG) antibodies were obtained from Cayman Chemical (Ann Arbor, MI, USA). The isotype control mouse IgG1, rabbit IgG, and goat IgG were purchased from Sigma-Aldrich. Non-enzymatic cell dissociation solution (CDS) was obtained from Sigma-Aldrich. All other reagents were obtained from Sigma-Aldrich, unless otherwise indicated.
Cells and Cell Culture
Human gingival fibroblasts were prepared from the explants of normal gingival tissues of six-year-old children, as described previously (Uehara et al., 2005a), under informed consent given by the parents because of the age of the donors. The experimental procedure was approved by the ethical review board (Tohoku University Graduate School of Dentistry).
Flow Cytometry
Flow cytometric analyses were performed with the use of a FACSCalibur cytometer (BD Biosciences, Mountain View, CA, USA). The cells were collected and washed in PBS. The cells were stained with anti-TLR2, anti-TLR4, and anti-MD-2 antibodies or control IgG at 4°C for 30 min, followed by fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (BioSource International, Camarillo, CA, USA) at 4°C for an additional 30 min. For TLR3, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 stainings, intracellular staining was performed. Briefly, the cells were washed with staining buffer, fixed, and permeabilized with BD Cytofix/Cytoperm solution (BD Biosciences) for 15 min at 4°C, and then the cells were incubated with primary antibodies or control IgG for 30 min, followed by FITC-conjugated secondary antibody at 4°C for anther 30 min.
RNA Extraction, Reverse Transcription, and Quantitative Polymerase Chain-reaction (PCR)
Gingival fibroblasts were cultured in 10-cm-diameter dishes to subconfluence. Total RNA and cDNA were prepared according to a method described previously (Uehara et al., 2005a). Using a programmed thermal cycler, we amplified cDNA in a solution containing 10 mM Tris-HCl (pH 8.0), 1.5 mM MgCl2, 50 mM KCl, 0.025 U/µL Taq DNA polymerase, and 0.2 µM of sense and antisense primers specific for each mRNA (Fig. 1a ) under optimal conditions for each primer set. Amplified samples were visualized on 2.0% agarose gels stained with ethidium bromide and photographed under UV light.

View larger version (66K):
[in this window]
[in a new window]
|
Figure 1. Expressions of TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 mRNA in human gingival fibroblasts. Fibroblasts were cultured until confluent at 37°C. After incubation, the total RNA was extracted, and the mRNA expressions of TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 were analyzed with PCR, with the primers shown in (a). The clear expressions of these mRNAs were detected (b). The results presented are representative of 3 different experiments demonstrating similar results.
|
|
Immunostaining
The cells were cultured on eight-chamber glass slides until confluent with or without test materials and washed with PBS. After fixation with 4% paraformaldehyde for 15 min, the cells were further treated with 0.5% Triton X-100 for 15 min for intracellular staining in the case of TLR3, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2. The cells were then incubated with anti-TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 antibodies for 3 hrs at room temperature. The samples were then washed and incubated with Alexa Fluor 488 goat anti-mouse IgG1, Alexa Fluor 488 rabbit anti-goat IgG, and Alexa 488 goat anti-rabbit IgG (Molecular Probes, Eugene, OR, USA), respectively. The nuclei were visualized by being stained with 4',6-diamino-2-phenylindole (Molecular Probes). Samples were photographed with an AxioCamMR monochrome digital camera mounted on a Zeiss AxioImager Z1 microscope, equipped with Zeiss AxioVision 4 software (Zeiss, Nürnberg, Germany). As negative controls, mouse IgG1 and normal rabbit serum (DakoCytomation, Tokyo, Japan) and normal goat serum (ZYMED, San Francisco, CA, USA) were used.
Cytokine Measurement
To investigate the production of inflammatory cytokines by gingival fibroblasts, we collected the supernatant from each culture. The production of cytokines (IL-6, IL-8, and MCP-1) was measured with the use of an OptEIA ELISA kits (PharMingen, San Diego, CA, USA). The concentrations of the cytokines in the supernatants were determined by means of the LS-PLATEmanager 2000 data analysis program (Wako Pure Chemical Industries, Osaka, Japan).
RNA Interference
Transfections for targeting endogenous NF- B p65 were carried out with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) and short-interfering (si) RNA (final concentration, 200 nM) for 24 hrs at 37°C, according to the manufacturers instructions. The viability of the cells after transfection was more than 95%, as assessed by a 0.2% trypan blue exclusion test, and the morphological character was not changed after transfection. siRNA for NF- B p65 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
 |
RESULTS
|
|---|
Gingival Fibroblasts Constitutively Expressed TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2
First, we demonstrated, using RT-PCR, that gingival fibroblasts constitutively expressed the mRNAs for TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 molecules (Fig. 1 ). Then, using flow cytometry, we demonstrated the cell-surface expressions of TLR1, TLR2, TLR4, MD-2, TLR5, and TLR6, and the intracellular expressions of TLR3, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 in gingival fibroblasts (Fig. 2 ), consistent with the results of RT-PCR. With immunostaining, TLR1, TLR2, TLR4, MD-2, TLR5, and TLR6 were clearly expressed on the cell surface, and TLR3, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 were constitutively expressed intracellularly (Fig. 3 ). In contrast, gingival fibroblasts were not stained with the negative controls mouse IgG, goat serum, or rabbit serum, followed by Alexa Fluor 488 (green) (data not shown).

View larger version (45K):
[in this window]
[in a new window]
|
Figure 2. Expressions of TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 in human gingival fibroblasts, detected by flow cytometry. Fibroblasts were cultured until confluent at 37°C. The cell-surface expressions of TLR1, TLR2, TLR4, MD-2, TLR5, TLR6, and intracellular TLR3, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 were assessed by flow cytometry. Thin lines represent the isotype Ab control. The results presented are representative of 4 different experiments demonstrating similar results.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Figure 3. Expressions of TLR1, TLR2, TLR3, TLR4, MD-2, TLR5, TLR6, TLR7, TLR8, TLR9, MyD88, NOD1, and NOD2 in human gingival fibroblasts, detected by immunostaining. Fibroblasts were cultured until confluent at 37°C. After fixation, the cells were treated with anti-TLR2, anti-TLR3, anti-TLR4, anti-TLR5, anti-TLR6, anti-TLR7, anti-TLR8, anti-TLR9, anti-MyD88, anti-NOD1, and anti-NOD2 antibodies and then visualized with Alexa Fluor 488 (green). The nuclei were visualized by being stained with 4',6-diamino-2-phenylindole (blue). Scale bars: 20 µm. The results are representative of 3 different experiments demonstrating similar results.
|
|
Induction of Pro-inflammatory Cytokines in Human Gingival Fibroblasts upon Stimulation with Chemically Synthesized TLR2/6, TLR3, TLR4, TLR7/8, TLR9, NOD1, and NOD2 Ligands
In this study, we examined whether TLRs and NODs expressed on human gingival fibroblasts actually functioned as receptors in terms of pro-inflammatory cytokine production upon stimulation with the respective ligands. It was found that FSL-1 (TLR2/6 agonist), Poly I:C (TLR3 agonist), lipid A (TLR4 agonist), ssPolyU (TLR7/8 agonist), CpG DNA (TLR9 agonist), FK156 (NOD1 agonist), and muramyl-dipeptide (NOD2 agonist) significantly induced the production of IL-6, IL-8, and MCP-1 (Fig. 4a ).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 4. IL-6, IL-8, and MCP-1 production induced by TLR and NOD ligands in human gingival fibroblasts was mediated by NF- B. (a) Fibroblasts were incubated for 24 hrs in the presence or absence of FSL-1 (1 nM), Poly I:C (10 µg/mL), lipid A (10 ng/mL), ssPolyU (10 µg/mL), CpG DNA (1 µM), FK156 (10 µg/mL), or MDP (10 µg/mL). IL-6, IL-8, and MCP-1 levels in the culture supernatants were determined with ELISA, and expressed as means ± SD. *Values marked differed significantly from those with medium alone (none). The results presented are representative of 3 different experiments demonstrating similar results. (b) Gingival fibroblasts transfected with siRNA targeting NF- B p65 for 24 hrs were stimulated with FSL-1 (1 nM), Poly I:C (10 µg/mL), lipid A (10 ng/mL), ssPolyU (10 µg/mL), CpG DNA (1 µM), FK156 (10 µg/mL), or MDP (10 µg/mL). After 24 hrs of stimulation, the IL-8 levels in the culture supernatants were determined with ELISA, and expressed as means ± SD. *,#Values marked differed significantly from those with medium alone or respective cultures stimulated with the indicated ligands, respectively. The results presented are representative of 4 different experiments demonstrating similar results.
|
|
Suppression of IL-8 Production Induced by Synthetic TLR and NOD Ligands with siRNA Targeting NF- B p65
To clarify the signaling pathway of cellular activation by these TLR and NOD ligands, we utilized RNA interference assays, targeting NF- B p65 mRNA. Many studies have showed that NOD1 and NOD2 signaling, as well as TLR signaling, activated NF- B (Ogura et al., 2001; Akira et al., 2006). Consistent with these reports, the up-regulated secretion of IL-8 induced by TLR and NOD ligands was significantly inhibited in NF- B p65-silenced cells (Fig. 4b ). These results demonstrate that TLRs and NODs on human gingival fibroblasts function as pattern recognition receptors and signaling molecules.
 |
DISCUSSION
|
|---|
Since fibroblasts are the major constituent of gingival connective tissue and are capable of producing various inflammatory cytokines (Takada et al., 1991; Tamura et al., 1992), it has been speculated that gingival fibroblasts actively participate in the inflammatory processes associated with periodontal diseases. As described above, however, only a limited repertoire of TLRs in gingival fibroblasts has been reported so far (Sugawara et al., 1998; Tamai et al., 2002; Hatakeyama et al., 2003; Wang et al., 2003; Okusawa et al., 2004). In the present study, we examined, in depth, the innate immune receptors in gingival fibroblasts, and demonstrated the clear expression of all TLRs (TLR1 to TLR9), MD-2, and MyD88 in gingival fibroblasts, although there were divergences in their expression (Figs. 1 –3 ). This is the first report on the expression of TLR1, TLR3, TLR5, TLR6, TLR7, TLR8, and TLR9 in gingival fibroblasts. Furthermore, we also showed the expression of NOD1 and NOD2 in the cells. In addition, stimulation with respective specific ligands, chemically synthesized to mimic microbial components, markedly up-regulated the production of pro-inflammatory cytokines, IL-6, IL-8, and MCP-1, indicating that these molecules in gingival fibroblasts are functional innate immune receptors.
In the case of most of the TLRs, the signaling pathways are mainly mediated by the activation of NF- B, although cell-surface TLR4 and intracellular TLRs (TLR3, TLR7, TLR8, and TLR9) also activate the cells via IRF-3 and/or IRF-7 (Akira et al., 2006). NOD1 and NOD2 signaling also activates NF- B (Inohara et al., 1999; Ogura et al., 2001). In the present study, we clearly demonstrated that various synthetic TLR and NOD ligands induce IL-6, IL-8, and MCP-1 production by gingival fibroblasts (Fig. 4 ). Since IL-6, IL-8, and MCP-1 possess an NF- B binding site in their promoter regions (Mizushima and Nagata, 1990; Yasumoto et al., 1992), our findings led us to expect that the induction of IL-6, IL-8, and MCP-1 through respective TLR or NOD molecules in gingival fibroblasts may involve NF- B activation. As we expected, the results with NF- B p65-silenced cells demonstrated that various TLR and NOD ligands exerted cytokine-inducing activity, mainly via NF- B (Fig. 4b ).
It has been controversial whether oral epithelial cells express TLRs, especially TLR4 (Asai et al., 2001; Kusumoto et al., 2004), in relation to their apparent unresponsiveness to various microbial products in terms of pro-inflammatory cytokine products. Recently, we have demonstrated, by immunohistochemical analysis, the clear expression of TLR4 as well as TLR2, and the strong expression of NOD1 and NOD2, in normal oral epithelial tissues, and also showed, using PCR, flow cytometry, and immunostaining, that primary oral epithelial cells in culture expressed these molecules (Sugawara et al., 2006). Furthermore, we found that oral epithelial cells expressed all TLRs (TLR1 to 9) (unpublished observations). It should be emphasized that the epithelial cells did not produce inflammatory cytokines upon stimulation with respective TLR or NOD ligands (Uehara et al., 2001, 2005b). In contrast, the cells produced antimicrobial factors, such as peptidoglycan recognition proteins (PGRPs), especially PGRP-I and -Iβ, and β-defensin 2. It is reasonable for epithelial cells to produce antimicrobial factors without the accompanying inflammatory cytokines upon stimulation with microbial components, because oral epithelial cells interact constitutively with the normal flora, and inflammatory responses might result in tissue destruction. In contrast, gingival fibroblasts are physiologically isolated from the normal flora, and only in tissue injury situations do they interact with microbes, which should induce inflammatory reactions, such as the pro-inflammatory cytokine production shown in this study. In other words, the excessive inflammatory reaction might be involved in the tissue destruction typically observed in periodontal diseases. Although the cytokines should properly be host-defense factors, those produced by fibroblasts might be harmful. However, further studies, especially in vivo studies, are required to demonstrate the above putative periodontal pathogenesis.
 |
ACKNOWLEDGMENTS
|
|---|
We thank D. Mrozek (Medical English Service, Kyoto, Japan) for organizing the review of this paper. This study was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (18390484) and by the Naito Memorial Foundation (to A.U.).
Received for publication July 11, 2006.
Revision received September 28, 2006.
Accepted for publication November 5, 2006.
 |
REFERENCES
|
|---|
- Akira S, Uematsu S, Takeuchi O (2006). Pathogen recognition and innate immunity. Cell 124:783–801.[CrossRef][Medline]
[Order article via Infotrieve]
- Asai Y, Ohyama Y, Gen K, Ogawa T (2001). Bacterial fimbriae and their peptides activate human gingival epithelial cells through Toll-like receptor 2. Infect Immun 69:7387–7395.[Abstract/Free Full Text]
- Buckley CD, Pilling D, Lord JM, Akbar AN, Scheel-Toellner D, Salmon M (2001). Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends Immunol 22:199–204.[CrossRef][Medline]
[Order article via Infotrieve]
- Chamaillard M, Hashimoto M, Horie Y, Masumoto J, Qiu S, Saab L, et al. (2003). An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat Immunol 4:702–707.[CrossRef][Medline]
[Order article via Infotrieve]
- Girardin SE, Boneca IG, Carneiro LA, Antignac A, Jéhanno M, Viala J, et al. (2003a). Nod1 detects a unique muropeptide from Gram-negative bacterial peptidoglycan. Science 300:1584–1587.[Abstract/Free Full Text]
- Girardin SE, Boneca IG, Viala J, Chamaillard M, Labigne A, Thomas G, et al. (2003b). Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J Biol Chem 278:8869–8872.[Abstract/Free Full Text]
- Hatakeyama J, Tamai R, Sugiyama A, Akashi S, Sugawara S, Takada H (2003). Contrasting responses of human gingival and periodontal ligament fibroblasts to bacterial cell-surface components through the CD14/Toll-like receptor system. Oral Microbiol Immunol 18:14–23.[CrossRef][Medline]
[Order article via Infotrieve]
- Inohara N, Koseki T, del Peso L, Hu Y, Yee C, Chen S, et al. (1999). Nod1, an Apaf-1-like activator of caspase-9 and nuclear factor-kappaB. J Biol Chem 274:14560–14567.[Abstract/Free Full Text]
- Inohara N, Ogura Y, Fontalba A, Gutierrez O, Pons F, Crespo J, et al. (2003). Host recognition of bacterial muramyl dipeptide mediated through NOD2. Implications for Crohns disease. J Biol Chem 278:5509–5512.[Abstract/Free Full Text]
- Kusumoto Y, Hirano H, Saitoh K, Yamada S, Takedachi M, Nozaki T, et al. (2004). Human gingival epithelial cells produce chemotactic factors interleukin-8 and monocyte chemoattractant protein-1 after stimulation with Porphyromonas gingivalis via Toll-like receptor 2. J Periodontol 75:370–379.[CrossRef][Medline]
[Order article via Infotrieve]
- Mizushima S, Nagata S (1990). pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res 18:5322.[Free Full Text]
- Ogura Y, Inohara N, Benito A, Chen FF, Yamaoka S, Núñez G (2001). Nod2, a Nod1/Apaf-1 family member that is restricted to monocytes and activates NF-kappaB. J Biol Chem 276:4812–4818.[Abstract/Free Full Text]
- Okusawa T, Fujita M, Nakamura J, Into T, Yasuda M, Yoshimura A, et al. (2004). Relationship between structures and biological activities of mycoplasmal diacylated lipopeptides and their recognition by Toll-like receptors 2 and 6. Infect Immun 72:1657–1665.[Abstract/Free Full Text]
- Sugawara S, Sugiyama A, Nemoto E, Rikiishi H, Takada H (1998). Heterogeneous expression and release of CD14 by human gingival fibroblasts: characterization and CD14-mediated interleukin-8 secretion in response to lipopolysaccharide. Infect Immun 66:3043–3049.[Abstract/Free Full Text]
- Sugawara Y, Uehara A, Fujimoto Y, Kusumoto S, Fukase K, Shibata K, et al. (2006). Toll-like receptors, NOD1 and NOD2, in oral epithelial cells. J Dent Res 85:524–529.
- Takada H, Mihara J, Morisaki I, Hamada S (1991). Induction of interleukin-1 and -6 in human gingival fibroblast cultures stimulated with Bacteroides lipopolysaccharides. Infect Immun 59:295–301.[Abstract/Free Full Text]
- Tamai R, Sakuta T, Matsushita K, Torii M, Takeuchi O, Akira S, et al. (2002). Human gingival CD14+ fibroblasts primed with gamma interferon increase production of interleukin-8 in response to lipopolysaccharide through up-regulation of membrane CD14 and MyD88 mRNA expression. Infect Immun 70:1272–1278.[Abstract/Free Full Text]
- Tamura M, Tokuda M, Nagaoka S, Takada H (1992). Lipopolysaccharides of Bacteroides intermedius (Prevotella intermedia) and Bacteroides (Porphyromonas) gingivalis induce interleukin-8 gene expression in human gingival fibroblast cultures. Infect Immun 60:4932–4937.[Abstract/Free Full Text]
- Uehara A, Sugawara S, Tamai R, Takada H (2001). Contrasting responses of human gingival and colonic epithelial cells to lipopolysaccharides, lipoteichoic acids and peptidoglycans in the presence of soluble CD14. Med Microbiol Immunol (Berl) 189:185–192.[CrossRef][Medline]
[Order article via Infotrieve]
- Uehara A, Muramoto K, Imamura T, Nakayama K, Potempa J, Travis J, et al. (2005a). Arginine-specific gingipains from Porphyromonas gingivalis stimulate production of hepatocyte growth factor (scatter factor) through protease-activated receptors in human gingival fibroblasts in culture. J Immunol 175:6076–6084.[Abstract/Free Full Text]
- Uehara A, Sugawara Y, Kurata S, Fujimoto Y, Fukase K, Kusumoto S, et al. (2005b). Chemically synthesized pathogen-associated molecular patterns increase the expression of peptidoglycan recognition proteins via Toll-like receptors, NOD1 and NOD2 in human oral epithelial cells. Cell Microbiol 7:675–686.[CrossRef][Medline]
[Order article via Infotrieve]
- Wang PL, Ohura K, Fujii T, Oido-Mori M, Kowashi Y, Kikuchi M, et al. (2003). DNA microarray analysis of human gingival fibroblasts from healthy and inflammatory gingival tissues. Biochem Biophys Res Commun 305:970–973.[CrossRef][Medline]
[Order article via Infotrieve]
- Yasumoto K, Okamoto S, Mukaida N, Murakami S, Mai M, Matsushima K (1992). Tumor necrosis factor alpha and interferon gamma synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-kB-like binding sites of the interleukin 8 gene. J Biol Chem 267:22506–22511.[Abstract/Free Full Text]
Journal of Dental Research, Vol. 86, No. 3,
249-254 (2007)
DOI: 10.1177/154405910708600310

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. E. King, A. W. Horne, S. Hombach-Klonisch, J. I. Mason, and H. O.D. Critchley
Differential expression and regulation of nuclear oligomerization domain proteins NOD1 and NOD2 in human endometrium: a potential role in innate immune protection and menstruation
Mol. Hum. Reprod.,
May 1, 2009;
15(5):
311 - 319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Selleri, M. Palazzo, S. Deola, E. Wang, A. Balsari, F. M. Marincola, and C. Rumio
Induction of pro-inflammatory programs in enteroendocrine cells by the Toll-like receptor agonists flagellin and bacterial LPS
Int. Immunol.,
August 1, 2008;
20(8):
961 - 970.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|