Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

CiteULike is a free service for managing and discovering scholarly references - click here to get started.

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Binderman, I.
Right arrow Articles by Yaffe, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Binderman, I.
Right arrow Articles by Yaffe, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

P2X4 is Up-regulated in Gingival Fibroblasts after Periodontal Surgery

I. Binderman1,*, H. Bahar1, J. Jacob-Hirsch2, S. Zeligson2, N. Amariglio2, G. Rechavi2, S. Shoham3 and A. Yaffe4

1 Department of Oral Biology, The Maurice and Gabriela Goldschleger School of Dental Medicine, Tel Aviv University, Tel Aviv 69978, Israel;
2 Department of Pediatric Hematology-Oncology, The Chaim Sheba Medical Center and Sackler School of Medicine, Tel Aviv University, Tel Aviv 52621, Israel;
3 Research Department, Herzog Hospital, Jerusalem, Israel; and
4 Department of Prosthodontics, Hebrew University Hadassah School of Dental Medicine, Ein Kerem, Jerusalem, Israel

Correspondence: * corresponding author, binderma{at}post.tau.ac.il


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Several studies have shown that surgical detachment of marginal gingiva close to the cervical cementum of molar teeth in a rat mandible is a distinct stimulus for alveolar bone resorption. Recently, we found that P2X4, an ATP-receptor, is significantly up-regulated in marginal gingival cells soon after surgery. We hypothesized that local release of ATP signaling through P2X4 elicits activation of osteoclasts on the alveolar bone surface. In this study, we identified intense immunoreactivity of gingival fibroblasts to P2X4-specific antibodies and a 6.4-fold increase in expression by real-time RT-PCR. Moreover, a single local application, at the time of surgery, of Apyrase (which degrades ATP) or Coomassie Brilliant Blue (an antagonist of purinoreceptors) significantly reduced alveolar bone loss. We propose that ATP flowing from cells after surgery can directly activate P2X4 receptors in the sensor cells of marginal gingiva through Ca2+ signaling, or by direct activation of osteoclasts on the bone surface.

Key Words: P2X4 purinoreceptor • marginal gingival fibroblasts • extracellular ATP • alveolar bone loss • osteoclasts


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A lveolar bone resorption and bone loss are the major consequences of periodontal diseases and periodontal surgery in humans, leading, in most cases, to loss of teeth. Several studies in our laboratory (Yaffe et al., 1995, 2003; Binderman et al., 2001) and others (Grevstad, 1993; Kaynak et al., 2000) have showed that surgical detachment of the marginal gingiva close to the cervical cementum of molar teeth in a rat mandible is a distinct stimulus for alveolar bone resorption. We have recently demonstrated that alveolar bone resorption commences only when the surgery is performed by the coronal approach, in contrast to an apical surgical approach (Binderman et al., 2001). Also, it is important to note that discarding the detached marginal gingiva, including cells, prevented alveolar bone resorption (Grevstad, 1993). Taken together, these findings suggest that the signal for alveolar bone resorption starts in the marginal gingiva, most probably due to the disruption of collagen fibers (Binderman et al., 2002). We have therefore undertaken to allocate the initial molecular signals that occur specifically in the marginal gingival cells after surgery. Global gene expression in the marginal gingiva of rats 20 min after surgery by the coronal approach was assessed in comparison with that after surgery by the apical approach (Binderman et al., 2001). Separate gene lists were created for induced genes and repressed genes in the coronal group in relation to the apical group; 65 genes were different (APPENDIX Tables). From the up-regulated genes, we considered the significant up-regulation of the purinoreceptor P2X4 gene (symbol P2rx4) very striking, since it was previously described as being directly involved in activating bone resorption (Hoebertz et al., 2000). Generally, P2X receptors are membrane ligand-gated ionic channels that open in response to the binding of extracellular ATP, allowing for a rapid increase in intracellular Ca2+ and an increase in the formation and activity of osteoclasts (Yu and Ferrier, 1994; Hoebertz et al., 2000; Jorgensen et al., 2002; Gallagher, 2004). We hypothesized that local release of ATP signaling through P2X4 elicits activation of osteoclasts on the alveolar bone surface. In the present study, we identified the expression of P2X4 in marginal gingiva cells using specific antibodies and measured gene expression by real-time RT-PCR after surgery. Also, we investigated the effects of Apyrase, which degrades extracellular ATP, or Coomassie Brilliant Blue, an antagonist of P2X receptors, applied locally at the time of surgery, on alveolar bone resorption 3 wks subsequently.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Experimental Procedure
This research was carried out in accordance with the Helsinki Accord at the animal care unit of the Faculty of Medicine, Tel Aviv University. Forty-four Wistar rats (from 300 to 340 g weight each) were used in this experiment. Fourteen rats were divided into 2 experimental groups; each group consisted of 7 rats. Prior to surgery, the rats were anesthesized with a mixture of 25 mg/kg body weight of ketamine HCl and 42 mg/kg body weight of xylazine hydrochloride administered intraperitoneally, as described previously (Yaffe et al. ,1995). In the first group, a coronal surgical approach included the incision and separation of the marginal gingiva from the cervical cementum and the mucoperiosteum, with the use of a small periosteal elevator (Binderman et al., 2001). In the second group, the surgical cut was performed at the periapical level, and elevation of the mucoperiosteum was made, as in a root resection procedure. In each group, the surgery was performed on both sides of the mandible, for a total of 28 sites. Twenty min after surgery, the marginal gingiva of 4 rats from each group was dissected out and frozen in liquid nitrogen. The gingival tissues of each group were minced, homogenized, and used for the isolation of total RNA. The RNA was also used to prepare double-stranded cDNA and to generate biotinylated cRNA, and then was hybridized on Affymetrix RG-230A rat chips (Affymetrix, Inc., Santa Clara, CA, USA). The screening for around 28,000 rat genes and expressed sequence tags (ESTs), followed by labeling and optical screening, was performed as described previously (Kannan et al., 2001).

Real-time RT-PCR
Total RNA was isolated from each group of pooled gingival tissues by the TRIzol method. A 100-µg quantity of total RNA was cleaned and precipitated with the use of an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) to prepare the template for reverse transcription. Reverse-transcription (RT) reaction was carried out with the Omniscript kit (Qiagen). The specific primer pairs for the P2X4 gene were (786F) TATTCCGTCTTGGCACAATCG and (936R) AGGCGCCGGAAGGAATATC, and the TaqMan probe was (881T) TGCAACCTGGATAGAGCCGCCTCC. Primer sets were synthesized at the Sigma facility. After denaturation at 95°C for 15 min, the 50-µL samples were subjected to 28–38 cycles of amplification, consisting of denaturation at 94°C for 1 min, annealing at 51.3–67°C for 1 min, and extension at 72°C at 1 min, followed by a final 10 min of extension at 72°C after completion of cycles. In each reaction, 18S rRNA was used as a reaction control. The results are presented as the mean of 2 experiments (Fig. 3Go).


Figure 3
View larger version (121K):
[in this window]
[in a new window]

 
Figure 3. Immunohistology of marginal gingiva and periodontium of rat molar tooth. (A) Histology of marginal gingiva and root (HE stain). Root dentin (De) and the emerging fibrous tissue with gingival fibroblasts (GF) aligned, running toward the periosteum and up toward the papillae. Part of the epithelium (Ep) is seen next to the root. (B) Cross-section of a molar tooth and its periodontium, including papillae of gingiva and PDL. Positive immunostaining with P2X4 antibodies (black) is seen specifically in the fibrous connective tissue of the papillae and PDL only. Alveolar bone (AB), epithelium (Ep), and dentin (De) were negative. (C,D) The same slide from the marginal periodontium after coronal approach surgery (treatment). (C) Positive immunostaining (black) for P2X4 receptors in the marginal gingival connective tissue, mainly fibroblasts. (D) The same, but illuminated by UV, showing the fibroblasts. (E,F) Similar. (F) Poor immunostaining for P2X4 in control sections where apical surgery was performed, from the marginal gingiva. The scale bars represent 50 µm.

 
Histology and Immunostaining
Three rats from each group were killed 20 min after surgery. Their mandibles, including the gingival tissue, were carefully dissected out and placed in 4% formalin in physiologically buffered saline (PBS). Tissue was formalin-fixed, then decalcified with 10% formic acid. Bucco-mesial paraffin sections (10 µm thick) were prepared and stained with hematoxylin and eosin. Also, 5-µm sections were mounted on SuperFrost Plus glass slides (Menzel Glaser, Braunschweig, Germany).

Sections were incubated with the primary antibody, rabbit anti-P2X4 (Catalog No. APR-002, Alomone Labs, Jerusalem, Israel). Sections were incubated with the primary antibody, diluted 1:100 in a medium containing 0.001% Trypsin inhibitor (Sigma soybean type IV), 0.3% Triton X-100, 0.05% Tween 20, 4% normal donkey serum (NDS) for 1 hr at room temperature, and then refrigerated overnight. Sections were rinsed in 0.02 M PBS, containing 4% NDS. Sections were incubated with biotinylated donkey anti-rabbit serum (catalog number AP182B, Chemicon USA, Temecula, CA, USA), diluted 1:400 in 0.02 M PBS, containing 0.3% Triton X-100, 0.05% Tween 20, and 4% NDS, for 1 hr at room temperature and then refrigerated overnight. Sections were rinsed in 0.02 M PBS containing 4% NDS and incubated with extravidin-peroxidase (Sigma Catalog number E2886), diluted 1:100 in 0.02 M PBS, for 45 min at room temperature. For color reaction, sections were incubated with a solution of diaminobenzidine (Sigma catalog number D5637) at a concentration of 0.0125% and containing 0.05% nickel ammonium sulfate for 10 min at room temperature and transferred to the same DAB solution, but with added hydrogen peroxide at a final concentration of 0.0015%. They were mounted on SuperFrost Plus glass slides (Menzel Glaser, Germany) and allowed to dry. They were then counterstained with the fluorescent dye DAPI (4',6-diamidino-2-phenylindole, dihydrochloride) (Molecular Probes, Eugene, OR, USA). DAPI was applied diluted in distilled, deionized water, 1:10,000, for 5 min at room temperature. It was then rinsed off with distilled, de-ionized water. After being dried thoroughly, slides were incubated in xylene and then cover-slipped in DPX. To control for specificity of staining, we processed a slide with the same protocol as above, except that the primary antibody solution also contained the antigen P2X4 (Alomone Labs, Jerusalem, Israel). The antibody concentration was 3 µg/mL, and the antigen concentration was 40 µg/mL. The primary antibody solution with the antigen was incubated for 1 hr at room temperature before application to the slide.

Treatments with Apyrase, Coomassie Blue R, Coomassie Blue G, and Suramin
Thirty rats were divided into 5 groups, each consisting of 6 rats. Each of the rats was anesthetized prior to surgery, as described previously (Yaffe et al., 1995, 2003). A flap was elevated with a special small periosteal elevator, on both sides of the mandible. Gelfoam pellets containing 10 µL of each of the drugs, namely, Apyrase, Sigma A Grade Vl (from potato lot 051k7019; 1 unit per 10 µL), Coomassie Blue R-250 (Bio Rad, Hercules, CA, USA) (10–4 M), Coomassie Blue G, Sigma (10–4 M), Suramin (10–4 M), and saline (10 µL) were applied. The Gelfoam pellet was applied between the alveolar bone and the mucoperiosteal flap. The rats were killed 21 days following the flap procedure. The mandibles were dissected out and fixed in 10% buffered formalin. The soft tissue was removed, and 1.5-mm-thick sections were prepared from the molar region only, in a buccal-lingual direction (4–5 sections from each side of the mandible) with the use of an IsoMet saw (Buehler, Lake Bluff, IL, USA). The sections represented the surgical area only.

Bone Loss Analysis
High-resolution x-ray microradiography was performed on all the sections in a mesio-distal direction, with Kodak Ektaspeed E safety film in a Faxitron cabinet x-ray system-Faxitron Series (Hewlett Packard), for 5 sec at 20 kVP. Sections from each rat were photographed on the same film, then scanned, image-processed, and analyzed for bone loss (Yaffe et al., 2003).

Statistical Analysis
The data are presented as the percentage of total sections in the treated-by-surgery or control sites for each group. Each treatment or control group was divided into 3 categories according to the classification of bone loss: no bone loss, N; moderate bone loss, V; or severe bone loss, H (Yaffe et al., 2003). The sections in each classification of bone loss category were counted as percentage of total sections. Statistical analysis with the paired Student’s t test was performed on each group. One-way analysis of variance confirmed a significant effect of the coronal and the apical surgeries. All results were considered significant at the 5% critical level.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The effect of surgical separation of the marginal gingiva from the mandibular molar rat teeth and mucoperiosteum, by the coronal surgical approach, resulted in extensive alveolar bone loss 3 wks later (Figs. 1A, 1BGo; and saline group in TableGo), with sites of resorption observable histologically (Fig. 1CGo), which have been previously described in detail in several publications (Yaffe et al., 1995, 2003; Binderman et al., 2001). Global gene expression in the marginal gingiva of rats after coronal approach surgery was assessed in comparison with expression after the apical approach (APPENDIX Tables). We found significant up-regulation (2.8-fold) of the purinoreceptor P2X4 gene. The microarray quantitative data were independently confirmed by real-time RT-PCR, which showed a 6.4-fold increase of P2X4 in the coronal group relative to the apical group (Fig. 2Go). The connective tissue of the marginal gingiva and PDL in the coronal group showed positive immunoreactivity for P2X4, while the epithelium, bone, and dentin were negative (Fig. 3BGo). The site of collagen fibers extending from the cervical root surface and the fibroblasts running along the fibers are visible in HE-stained sections (Fig. 3AGo). A specific and intense positive immunohistochemical reaction of fibroblasts in the marginal gingiva and in periodontal ligament for P2X4 (Figs. 3C, 3DGo) in the coronal group, relative to the apical group (Figs. 3D, 3EGo) can be seen. When primary antibody solution (3 µg/mL) was pre-mixed with antigen P2X4 (40 µg/mL), blocking of immunoreactivity was observed, indicating the specificity of the antibody reaction for P2X4 (not shown). Apyrase, an enzyme that quickly hydrolyzes 5' nucleotide triphosphate to monophosphate, was applied locally at the surgical site in rats that underwent surgery by the coronal approach. In fact, 1 unit of Apyrase in 10 µL of solution, placed only once at the time of surgery, significantly increased (two-fold) the number of sections with no bone loss 3 wks after surgery, as measured from microradiographs of mandibular cross-sections (TableGo) and described previously (Yaffe et al., 1995, 2003; Binderman et al., 2001). In another series of experiments, local application of known antagonists of P2 receptors, namely, Coomassie Blue R or G, increased (1.7- and 1.5-fold, respectively) the number of sections with no alveolar bone loss, while suramin was ineffective in reducing alveolar bone loss (TableGo). When Coomassie Blue R was applied at nM concentrations, it was ineffective (data not shown).


Figure 1
View larger version (96K):
[in this window]
[in a new window]

 
Figure 1. Microradiographic and histological presentation of periodontal tissues, namely, the tooth root surface (cementum), marginal gingiva, periodontal ligament, and alveolar bone. Microradiographs of cross-sectioned mandible in the molar region showing (A) normal alveolar bone (N = no bone loss), or (B) where moderate alveolar bone loss (V) can be observed (white arrows) without loss of bone crest. Bars = 1 mm. (C) Histological section of periodontal tissue showing typical alveolar bone resorption (R+white arrows), indicating pits of bone-resorbing sites, on the inner aspect of alveolar bone (next to periodontal ligament). D, dentin; AB, alveolar bone. Bar = 100µ.

 

View this table:
[in this window]
[in a new window]

 
Table. The Effects of Local Application of Apyrase, Coomassie Blue-R (R-Coomassie), Coomassie Blue-G (G-Coomassie), Suramin, and Saline in Preventing Alveolar Bone Loss
 

Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Figure 2. Relative fold increase in expression of P2X4 measured by real-time quantitative RT-PCR. Verification of P2X4 induced expression in gingival tissue 20 min after the coronal surgical approach (COR) and after the apical surgical approach (AP).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The P2X4 receptor has been identified in the rabbit osteoclast cDNA library (Naemsch et al., 1999). P2X receptors have been implicated in the generation of osteoclasts via up-regulation of osteoblast-expressed receptor, an activator of nuclear factor-{kappa}B ligand (RANKL), and an important link in the formation and activation of osteoclasts (Hoebertz et al., 2000; Buckley et al., 2002). The presence of other, both functional, P2X and P2Y receptors has been demonstrated in rats and human osteoclast cells (Dixon and Sims, 2000; Jorgensen et al., 2002; Hoebertz et al., 2003). Here, we are first to identify the P2X4 ligand-gated ion channel purinoreceptor in the membranes of marginal gingival cells at some distance from bone. The immuno-positively stained fibroblasts, aligned along the bundles of collagen fibers in the coronal approach surgery, suggest the presence of an intimate cellular communication path, from the coronal part of the root surface toward the alveolar bone. Our findings showed molecular changes as soon as 20 min after surgery. Later timepoints are now being tested for P2X4 expression.

ATP, which is the extracellular ligand of P2X and P2Y receptors, is released locally from cells, due to mechanical deformation or cell damage induced by surgery, trauma, hypoxia, and ischemia (Buckley et al., 2002; Loomis et al., 2003). ATP flowing from damaged cells interacts directly with its purinoreceptors, stimulating the intracellular influx of calcium (Yu and Ferrier, 1994: Bumstock, 1997; Gallagher, 2004). We speculated that the propagation of the signal by intercellular ionic calcium, and by the flow of ATP toward the alveolar bone surface, can exert appreciable stimulatory effects on the formation and acivity of osteoclasts. The cells that ultimately resorb bone, the osteoclasts, may not be the same ones that sense the surgical insult and strain deprivation. In fact, our experiments demonstrated that local application, at the site of surgery, of Apyrase, which degrades the extracellular ATP, significantly reduced alveolar bone resorption. It has been shown that blocking the P2X receptor with the antagonist, oxidized ATP, inhibited osteoclasts formation in vitro and, therefore, that it may inhibit bone resorption (Dixon and Sims, 2000). In the present study, inhibitors of purinoreceptors, such as Coomassie Blue R and G, reduced alveolar bone loss significantly (Jiang et al., 2000).

In summary, surgical splitting of the fibers of the marginal gingiva stimulated an early up-regulation of the P2X4 receptor for extracellular ATP. We propose that the P2X4 purinoreceptor is the mechanosensor of strain deprivation in the gingival fibroblasts. It seems that controlling the level of extracellular ATP and its receptors locally, in the marginal gingival environment, will effectively reduce alveolar bone loss after periodontal surgery.


    ACKNOWLEDGMENTS
 
Three authors (IB, HB, and AY) contributed equally to this work. Three authors (GR, JJ-H, SZ, and NA) contributed especially to the molecular aspect of the work. SS contributed to the immunohistochemistry. This work was supported by grant No. 576 from the Chief Scientist, Ministry of Health, Israel.


    FOOTNOTES
 
A supplemental appendix to this article is published electronically only at http://www.dentalresearch.org.

Received for publication January 5, 2006. Revision received October 16, 2006. Accepted for publication October 31, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Binderman I, Adut M, Zohar R, Bahar H, Faibish D, Yaffe A (2001). Alveolar bone resorption following coronal versus apical approach in a mucoperiosteal flap surgery procedure in the rat mandible. J Periodontol 72:1348–1353.[Medline] [Order article via Infotrieve]
  • Binderman I, Bahar H, Yaffe A (2002). Strain relaxation of fibroblasts in the marginal periodontium is the common trigger for alveolar bone resorption: a novel hypothesis. J Periodontol 73:1210–1215.[CrossRef][Medline] [Order article via Infotrieve]
  • Buckley KA, Hipskind RA, Gartland A, Bowler WB, Gallagher JA (2002). Adenosine triphosphate stimulates human osteoclast activity via upregulation of osteoblast-expressed receptor activator of nuclear factor-kappa B ligand. Bone 31:582–590.
  • Burnstock G (1997). The past, present and future of purine nucleotides as signalling molecules. Neuropharmacology 36:1127–1139.[CrossRef][Medline] [Order article via Infotrieve]
  • Dixon SJ, Sims SM (2000). P2 purinergic receptors on osteoblasts and osteoclasts: potential targets for drug development. Drug Dev Res 49:187–200.[Medline] [Order article via Infotrieve]
  • Gallagher JA (2004). ATP P2 receptors and regulation of bone effectors cells. J Musculoskelet Neuronal Interact 4:125–127.[Medline] [Order article via Infotrieve]
  • Grevstad HJ (1993). Doxycycline prevents root resorption and alveolar bone loss in rats after periodontal surgery. Scand J Dent Res 101:287–291.[Medline] [Order article via Infotrieve]
  • Hoebertz A, Townsend-Nicholson A, Glass R, Burnstock G, Arnett TR (2000). Expression of P2 receptors in bone and cultured bone cells. Bone 27:503–510.
  • Hoebertz A, Arnett TR, Burnstock G (2003). Regulation of bone resorption and formation by purines and pyrimidines. Trends Pharmacol Sci 24:290–297.[CrossRef][Medline] [Order article via Infotrieve]
  • Jiang LH, Mackenzie AB, North RA, Surprenant A (2000). Brilliant blue G selectively blocks ATP-gated rat P2X(7) receptors. Mol Pharmacol 58:82–88.[Abstract/Free Full Text]
  • Jorgensen NR, Henriksen Z, Sorensen OH, Eriksen EF, Civitelli R, Steinberg TH (2002). Intercellular calcium signaling occurs between human osteoblasts and osteoclasts and requires activation of osteoclast P2X7 receptors. J Biol Chem 277:7574–7580.[Abstract/Free Full Text]
  • Kannan K, Amariglio N, Rechavi G, Jakob-Hirsch J, Kela I, Kaminski N, et al. (2001). DNA microarrays identification of primary and secondary target genes regulated by p53. Oncogene 20:2225–2234.[CrossRef][Medline] [Order article via Infotrieve]
  • Kaynak D, Meffert R, Gunhan M, Gunhan O, Ozkaya O (2000). A histopathological investigation on the effects of the bisphosphonate alendronate on resorptive phase following mucoperiosteal flap surgery in the mandible of rats. J Periodontol 71:790–796.[Medline] [Order article via Infotrieve]
  • Loomis WH, Namiki S, Ostrom RS, Insel PA, Junger WH (2003). Hypertonic stress increases T cell interleukin-2 expression through a mechanism that involves ATP release, P2 receptor, and P38 MAPK activation. J Biol Chem 278:4590–4596.[Abstract/Free Full Text]
  • Naemsch LN, Weidema AF, Sims SM, Underhill TM, Dixon SJ (1999). P2X4 purinoreceptors mediate an ATP-activated, non selective cation current in rabbit osteoclasts. J Cell Sci 112:4425–4435.[Abstract]
  • Yaffe A, Fine N, Alt I, Biederman I (1995). The effect of bisphosphonate on alveolar bone resorption following mucoperiosteal flap surgery in the mandible of rats. J Periodontol 66:999–1003.[Medline] [Order article via Infotrieve]
  • Yaffe A, Herman A, Bahar H, Biederman I (2003). Combined local application of tetracycline and bisphosphonate reduces alveolar bone resorption in rats. J Periodontol 74:1038–1042.[Medline] [Order article via Infotrieve]
  • Yu H, Ferrier J (1994). Mechanisms of ATP-induced Ca+2 signaling in osteoclasts. Cell Signal 6:905–914.[CrossRef][Medline] [Order article via Infotrieve]

Journal of Dental Research, Vol. 86, No. 2, 181-185 (2007)
DOI: 10.1177/154405910708600214


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JDRHome page
V. Krishnan and Z. Davidovitch
On a Path to Unfolding the Biological Mechanisms of Orthodontic Tooth Movement
Journal of Dental Research, July 1, 2009; 88(7): 597 - 608.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Binderman, I.
Right arrow Articles by Yaffe, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Binderman, I.
Right arrow Articles by Yaffe, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?