Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Kanzaki, H.
Right arrow Articles by Mitani, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanzaki, H.
Right arrow Articles by Mitani, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Cyclical Tensile Force on Periodontal Ligament Cells Inhibits Osteoclastogenesis through OPG Induction

H. Kanzaki1,*, M. Chiba2, A. Sato2, A. Miyagawa2, K. Arai1, S. Nukatsuka1 and H. Mitani1

1 Division of Orthodontics and Dentofacial Orthopedics, and
2 Division of Oral Dysfunction Science, Department of Oral Health and Development Sciences, Graduate School of Dentistry, Tohoku University, 4-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan

Correspondence: * corresponding author, kanzaki{at}mail.tains.tohoku.ac.jp


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The periodontal ligament (PDL) maintains homeostasis of periodontal tissue under mechanical tensile-loading caused by mastication. Occlusal load inhibits atrophic alveolar bone resorption. Previously, we discovered that continuous compressive force on PDL cells induced osteoclastogenesis-supporting activity, with up-regulation of RANKL. We hypothesized that, unlike compression, cyclical tensile force up-regulates OPG expression in PDL cells via TGF-beta up-regulation, and does not induce osteoclastogenesis-supporting activity. PDL cells were mechanically stimulated by cyclical tensile force in vitro. The conditioned media of PDL cells that had been subjected to cyclical tensile force inhibited osteoclastogenesis. Cyclical tensile force up-regulated not only RANKL mRNA expression, but also OPG mRNA expression in PDL cells. Tensile force up-regulated TGF-beta expression in PDL cells as well. Administration of neutralizing antibodies to TGF-beta inhibited OPG up-regulation under cyclical tensile-force stimulation in a dose-dependent manner. Additionally, the osteoclastogenesis-inhibitory effect of the conditioned media of PDL cells under cyclical tensile force was partially rescued by the administration of TGF-beta neutralizing antibodies. In conclusion, tensile force inhibited the osteoclastogenesis-supporting activity of PDL cells by inducing the up-regulation of OPG via TGF-beta stimulation.

Key Words: osteoprotegerin (OPG) • TGF-beta • occlusal force • tensile force • osteoclastogenesis


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The periodontal ligament (PDL) is a highly specialized connective tissue that lies between the cementum and the alveolar bone, maintaining their homeostasis while continuously being subjected to the mechanical tensile loading caused by occlusion and mastication (Davidovitch et al., 1988; Lekic and McCulloch, 1996). When a tooth has lost occlusion, atrophy of periodontal tissue from disuse occurs, and alveolar bone starts being resorbed (Cohn, 1965, 1966). In other words, PDL cells respond to a moderate cyclical occlusal load, and suppression of osteoclastic bone resorption occurs in alveolar bone. However, the osteoclastogenesis-supporting activity of the PDL cells under tensile force is not clear.

PDL cells have osteoblastic properties, such as high alkaline phosphatase (ALP), and can express osteocalcin and form mineral-like nodules (Basdra and Komposch, 1997). In addition, it has been reported that cyclical tensile forces stimulate PDL cells. Tensile forces regulate the production of cytokines and chemical mediators such as IL-1 or PGE2 in PDL cells (Saito et al., 1991; Shimizu et al., 1994; Yamaguchi et al., 1994). Tensile-force load induces the expression of transforming growth factor-beta (TGF-beta), and this generates mitogenic responses (Bellows et al., 1982). Application of a tensile-force load to PDL cells up-regulated osteoblastic differentiation (Matsuda et al., 1998).

Osteoclastogenesis is mainly regulated by two cytokines, receptor activator of nuclear factor kappa B ligand (RANKL) and macrophage colony-stimulating factor (M-CSF) (Udagawa, 2002). RANKL signaling is inhibited by osteoprotegerin (OPG), and a balance between RANKL and OPG contributes to regulation of bone resorption (Hofbauer et al., 2000).

Previously, we discovered that the application of continuous compressive force to PDL cells induced osteoclastogenesis-supporting activity (Kanzaki et al., 2002). Static mechanical compression promotes osteoclastogenesis via the up-regulation of RANKL expression in PDL cells (Kanzaki et al., 2002). However, we found that compressive force did not change the level of OPG expressed in PDL cells. Recently, Tsuji et al. reported that OPG up-regulation was observed in tensile-stimulated PDL cells (Tsuji et al., 2004). Because tensile forces induce TGF-beta expression (Bellows et al., 1982), and OPG production is negatively regulated by TGF-beta (Horowitz et al., 2001), we assumed that the up-regulation of OPG by tensile forces might be TGF-beta-dependent.

We hypothesized that the application of a cyclical tensile force up-regulates not only RANKL expression but also OPG expression in PDL cells via up-regulation of TGF-beta, and does not induce osteoclastogenesis-supporting activity. To test this hypothesis, we used a primary cell culture system with human PDL cells and peripheral blood mononuclear cells (PBMCs) containing osteoclast precursors.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cells
The protocol for these experiments was reviewed and approved by the Research Ethics Committee of Tohoku University School of Dentistry. Informed consent was obtained from all volunteers.

Peripheral Blood Mononuclear Cells (PBMCs)
We used PBMCs for osteoclast precursors. A peripheral blood sample was obtained from healthy adult male donors. Cells were collected by gradient-centrifugation (1.077 g/mL, 3000 rpm,4°C, for 30 min) and then suspended in alpha minimal essential medium ({alpha}-MEM; Flow Laboratories, Inc., McLean, VA, USA) containing 10% (vol/vol) fetal bovine serum (FBS; Biocell Laboratories, Rancho Dominguez, CA, USA) and supplemented with antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin).

Primary Human PDL Cells
Pieces of PDL, obtained from teeth extracted for orthodontic reasons, were taken only from the middle of the tooth root, to exclude contamination from the gingivae and dental pulp. They were cultured in {alpha}-MEM containing 20% FBS and supplemented with five-fold-reinforced antibiotics in Primaria (Falcon, Becton Dickinson, Lincoln Park, NJ, USA). Cells that grew from the extracts were passaged. The PDL cells used in these experiments underwent from 4 to 8 passages.

Cell Culture
All cells were cultured in 10% FBS {alpha}-MEM supplemented with antibiotics at 37°C in a 5% CO2 incubator. The medium was changed every 5 days throughout the experiments.

Application of Cyclical Tensile Force
Cyclical tensile force was applied to PDL cells with a Flexercell Strain-Unit (Flexcell Corp., Hillsborough, NC, USA). PDL cells were pre-cultured in flexible-bottomed culture plates until confluence. The base of the culture plate consisted of type I collagen-coated silicone membrane. Flexible-bottomed culture plates were fixed onto a rubber gasket of the Flexercell Strain Unit. PDL cells were subjected to cyclical tensile force (15% elongation, 1 sec stretch/1 sec relaxation) for 0.5, 1.5, 6, 24, 48, and 72 hrs. The PDL cells were then subjected to RNA extraction, and the conditioned medium was collected.

Neutralizing Effect of Anti-TGF-beta1 Antibodies on OPG Production from PDL Cells
Twenty-four hours before tensile-force loading, anti-human TGF-beta1 neutralizing antibody [high-concentration (Hi-Ab.), 40 µg/mL; medium-concentration (Mi-Ab.), 10 µg/mL; low-concentration (Lo-Ab.), 2.5 µg/mL; R&D Systems Inc., Minneapolis, MN, USA] was added to the conditioned medium. The PDL cells were then subjected to the cyclical tensile force described above for 72 hrs, RNA was extracted, and conditioned medium was collected.

Resorption Assay
PBMCs (106cells/mL) were cultured with 50% collected conditioned medium of stimulated PDL cells in 10% FBS {alpha}-MEM supplemented with 1 x 10–8 M of 1,25-(OH)2D3 (Duphar, Amsterdam, Netherlands) for 3 wks. After incubation, the adherent cells were stained for tartrate-resistant acid phosphatase (TRAP) activity by means of a Leukocyte Acid Phosphatase kit (Sigma, St. Louis, MO, USA), according to the manufacturer’s instructions.

In addition, we observed pit-formation activity using dentin slices. Briefly, PBMCs were cultured on bovine dentin slices for 3 wks. The dentin slices were then incubated with ammonium-hydroxide (0.25 M). Resorption lacunae were visualized in hematoxylin solution.

Immunofluorescence Analysis for Cathepsin K and {alpha}vβ3 Integrin
Cultured PDL cells were fixed and rinsed. The cells were then permeabilized in 0.1% Triton X-100 in PBS for 15 min. Cells were incubated in 5% skim milk in PBS to block non-specific reactions and were subsequently incubated with the primary antibody. After being thoroughly rinsed, the cells were incubated with FITC-conjugated secondary antibodies, washed, mounted in PBS-glycerol, and observed.

Assay of OPG and TGF-beta Production from PDL Cells
The amount of OPG released into the conditioned medium was determined by use of a Human Osteoprotegerin ELISA Kit (BioVendor Laboratory Medicine Inc., Modrice, Czech Republic). Similarly, the amount of TGF-beta released into the conditioned medium was determined by use of an enzyme immunoassay kit (Biosource Europe S.A., Nivelles, Belgium).

RNA Extraction and Semi-quantitative Reverse-transcription Polymerase Chain-reaction Assay (RT-PCR)
Total RNA was extracted from each culture by means of the QuickPrep Total RNA Extraction Kit (Pharmacia Biotech, Uppsala, Sweden). RNA was reverse-transcribed with You-Prime FirstStrand-Beads (Pharmacia Biotech) and an Oligo(dT)15 primer (Promega, Madison, WI, USA) according to the manufacturer’s instructions.

First-strand complementary DNA (cDNA) was subjected to polymerase chain-reaction (PCR) amplification with gene-specific PCR primers. PCR was performed with the use of a KOD-Dash DNA Polymerase Kit (Toyobo Co., Ltd., Tokyo, Japan), according to the manufacturer’s instructions. Each cycle consisted of a heat-denaturation at 94°C for 30 sec, an annealing at a temperature optimized for each primer-pair (β-Actin [BC013835.1, 640-966 bp]: upstream, ATGAGGATCCTCACCGAGCGCGGCTACAGC; downstream, ACACCACTGTGTTGGCGTACAGGTCTTTGC, 68°C; RANKL [AF053712, 607-947 bp]: upstream, AGCAG AGAAAGCGATGGT; downstream, GGGTATGAGAACTTGGG ATT, 52°C; OPG [U94332, 371-712 bp]: upstream, TCAA GCAGGAGTGCAATCG; downstream, AGAATGCCTCC TCACACAGG, 57°C; TGF-beta [BC000125.1, 1281-1616 bp]: upstream, GCCCTGGACACCAACTATTGC; downstream, GCTGCACTTGCAGGAGCGCAC, 64°C) for 2 sec, and extension at 74°C for 30 sec. The PCR products underwent electrophoresis and were visualized by ethidium-bromide staining with UV-light illumination (GelDoc2000; Bio-Rad, Hercules, CA, USA). The relative intensities of the gel bands were measured by ScionImage (Scion Co., Frederick, MD, USA).

Statistical Analysis
Data were analyzed for statistically significant differences by the Kruskal-Wallis test, followed by the Bonferroni-type multiple comparisons. Results are expressed as the mean ± standard deviation (SD).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Conditioned Medium of PDL Cells under Cyclical Tensile Force Inhibited Osteoclastogenesis
Fewer PBMCs that were cultured with the conditioned medium of PDL cells differentiated into TRAP-positive multinucleated cells (Figs. 1b–1eGo) compared with the control PBMCs (49 ± 8 cells/mm2) (Figs. 1a, 1fGo). This inhibition was clearly seen in the PBMCs cultured with the conditioned medium of PDL cells that had been subjected to tensile force (12 ± 2 cells/mm2) (Figs. 1d, 1fGo). However, these inhibitions were rescued by the addition of anti-TGF-beta antibodies (22 ± 4 cells/mm2) (Figs. 1e, 1fGo). There was no significant difference in the total number of attached cells between the samples (data not shown).


Figure 1
View larger version (47K):
[in this window]
[in a new window]

 
Figure 1. Osteoclastogenesis from PBMCs. (a–f) TRAP-staining. Bar = 100 µm. (a) PBMCs cultured in 10% FBS {alpha}-MEM supplemented with 1 x 10–8 M of 1,25-(OH)2D3. (b) PBMCs cultured with 50% conditioned medium of control PDL cells. (c) PBMCs cultured with 50% conditioned medium of control PDL cells in the presence of anti-TGF-beta antibodies (10.4 µg/mL). (d) PBMCs cultured with 50% conditioned medium of PDL cells under tensile force. (e) PBMCs cultured with 50% conditioned medium of PDL cells under tensile force in the presence of anti-TGF-beta antibodies (10.4 µg/mL). (f) The number of TRAP-positive multinucleated cells was counted. The data are expressed as the mean ± SD of 12 measurements of 3 wells. **p < 0.01, *p < 0.05. (g–i) Immunohistochemical staining of PBMCs for cathepsin K. Bar = 100 µm. (g) Photograph after TRAP-staining. (h) Immunohistochemical staining of PBMCs for cathepsin K. (i) Merged image of (g) and (h). (j–L) Immunohistochemical staining of PBMCs for. {alpha}vβ3 integrin. Bar = 100 µm (j) Photograph after TRAP-staining. (k) Immunohistochemical staining of PBMCs for {alpha}vβ3 integrin. (L) Merged image of (j) and (k). (m–o) Pit assay. Bar = 100 µm. (m) Negative control. (n) PBMCs cultured with 1,25(OH)2D3. (o) PBMCs cultured with the conditioned medium of tensile-stimulated PDL cells and 1,25(OH)2D3. White arrow indicates resorption pit.

 
To examine whether these TRAP-positive multinucleated cells have other osteoclast characteristics, we performed the pit-formation assay and immunohistochemical staining for cathepsin K and {alpha}vβ3 integrin (Figs. 1g–1oGo). After 3 wks of incubation, many resorption pits were observed in the control samples (Fig. 1nGo). However, the number of resorption pits was significantly reduced in samples that had been cultured with the conditioned medium of stimulated PDL cells (Fig. 1oGo). TRAP-positive multinucleated cells that had formed from PBMCs expressed both cathepsin K and {alpha}vβ3 integrin (Figs. 1g–1LGo).

Cyclical Tensile Force Up-regulated both RANKL and OPG mRNA Expression in PDL Cells
Cyclical tensile force up-regulated OPG mRNA expression as well as RANKL mRNA expression in PDL cells (Figs. 2a–2cGo). Anti-TGF-beta antibodies inhibited OPG mRNA up-regulation in PDL cells that had been stimulated by cyclical tensile force (Figs. 2a, 2cGo).


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
Figure 2. Results of semi-quantitative RT-PCR. (a) RT-PCR analysis for TGF-beta1, OPG, and RANKL in PDL cells. PDL cells were subjected to a cyclical tensile force for 48 hrs in the presence or absence of anti-TGF-beta antibodies (10 µg/mL). The results of one of three representative independent experiments are shown. (b,c) Densitometric analysis (b, RANKL; c, OPG; and TGF-beta1). The results are expressed as the ratio to the level of β-actin expression in three independent experiments. The results are expressed as the mean ± SD. *p < 0.05.

 
Cyclical Tensile Force Induced OPG Production from PDL Cells (Fig. 3Go)
PDL cells constitutively express OPG, and this constitutive OPG expression was not inhibited by anti-TGF-beta antibodies (No-Ab., 210 ± 20 pmol/L; Lo-Ab., 216 ± 22 pmol/L; Mi-Ab., 206 ± 19 pmol/L; Hi-Ab., 201 ± 20 pmol/:). Tensile force significantly up-regulated OPG production (tensile + No-Ab., 278 ± 23 pmol/L). This increase was inhibited dose-dependently by anti-TGF-beta antibodies (tensile + Lo-Ab., 252 ± 21 pmol/L; tensile + Mi-Ab., 228 ± 22 pmol/L; tensile + Hi-Ab., 189 ± 19 pmol/L).


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Figure 3. OPG production from stimulated PDL cells. Cyclical tensile force increased OPG production in PDL cells. The conditioned medium of PDL cells that had been stimulated by tensile force in the presence or absence of anti-TGF-beta antibodies (Hi, 40 µg/mL; Mi, 10 µg/mL; Lo, 2.5 µg/mL) was collected, and the level of OPG in the conditioned medium was measured with the use of an ELISA kit. The data are expressed as the mean ± SD of 3 independent experiments. Statistically significant between groups ({dagger}p < 0.05, {dagger}{dagger}p < 0.01) or vs. control (*p < 0.05, **p < 0.01).

 
Cyclical Tensile Force Induced TGF-beta Production from PDL Cells
RT-PCR analysis revealed that cyclical tensile force up-regulated TGF-beta mRNA expression in PDL cells (Figs. 2a, 2cGo). Anti-TGF-beta antibodies inhibited the up-regulation of TGF-beta mRNA in PDL cells stimulated by cyclical tensile force (Figs. 2a, 2cGo). In other words, the response of TGF-beta1 mRNA expression to tensile force indicated almost the same response pattern as the OPG mRNA expression to tensile force.

The level of TGF-beta in the conditioned medium of PDL cells was measured by ELISA (Fig. 4Go). We performed two independent experiments. In Experiment 1, PDL cells were subjected to tensile stimulation for 0, 6, 24, or 48 hrs, and in Experiment 2, PDL cells were subjected to tensile stimulation for 0, 24, 48, or 72 hrs. Until tensile stimulation for up to 24 hrs, there were only slight increases in TGF-beta production, without significant differences (0 hr, 1.69 ± 0.08 ng/mL; 6 hrs, 1.73 ± 0.04 ng/mL; 24 hrs, 1.77 ± 0.12 ng/mL, respectively). Upon tensile stimulation for 48 hrs or longer, TGF-beta production significantly increased (0 hr, 1.74 ± 0.11 ng/mL; 48 hrs (Exp 1), 1.97 ± 0.18 ng/mL; 48 hrs (Exp 2), 1.91 ± 0.13 ng/mL; 72 hrs, 1.94 ± 0.17 ng/mL, respectively).


Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
Figure 4. TGF-beta production from stimulated PDL cells. Application of cyclical tensile force increased TGF-beta production in PDL cells. The conditioned medium of PDL cells that had been stimulated by tensile force (Experiment 1 - 0, 6, 24, or 48 hrs; Experiment 2 - 0, 24, 48, or 72 hrs) was collected, and the level of TGF-beta in the conditioned medium was measured with the use of an ELISA kit. The data are expressed as the mean ± SD of 3 measurements. *p < 0.05: Statistically significant vs. 0 hr.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Healthy periodontal ligament is loaded with cyclical tensile force during occlusion, which maintains alveolar bone homeostasis (Davidovitch et al., 1988). In contrast, loss of occlusion results in considerable loss of interdental bone, apical proliferation of the epithelial attachment, and narrowing of the interdental space (Cohn, 1966). In this study, we used a Flexercell strain unit to load a cyclical tensile force. The cyclical tensile force applied in this study (15% elongation) was moderate compared with that used in a previous study (21% elongation; Yoshino et al., 2003). We hypothesized that our experimental design would enable us to clarify how tensile force supports PDL cells to maintain alveolar bone homeostasis.

Osteoclastogenesis is mainly regulated by the RANKL/OPG ratio (Hofbauer et al., 2000), and we previously found that application of continuous compressive force to the PDL cells induced osteoclastogenesis-supporting activity via up-regulation of RANKL (Kanzaki et al., 2002). However, the level of OPG expression in compressed PDL cells did not significantly change, despite compression and despite the fact that the RANKL/OPG ratio became larger (Kanzaki et al., 2002). Recently, up-regulation of OPG was observed in tensile-stimulated PDL cells (Tsuji et al., 2004). Analysis of our OPG ELISA data showed similar up-regulation by tensile stimulation (Fig. 3Go). Many cytokines and chemical mediators regulate the expression of RANKL and OPG. RANKL production is positively regulated by 1,25-(OH)2D3, IL-1β, and PGE2 (Hofbauer et al., 2000; Troen, 2003). OPG production is negatively regulated by glucocorticoids, PGE2, and PTH, while it is positively regulated by 1,25-(OH)2D3 and TGF-beta (Horowitz et al., 2001). Because TGF-beta expression is induced in PDL cells by tensile-force load (Bellows et al., 1982), we hypothesized that TGF-beta might regulate the tensile-force-stimulated up-regulation of OPG in PDL cells. In these experiments, tensile force significantly up-regulated TGF-beta expression and OPG expression in PDL cells (Figs.3Go, 4Go). In addition, anti-TGF-beta antibodies inhibited the up-regulation of OPG by tensile force in a dose-dependent manner (Fig. 3Go). The concentration range of anti-TGF-beta neutralizing antibodies used in this study (40, 10, 2.5 µg/mL) was similar to those used in other reports (20 µg/mL, Kaneda et al., 2000; 40 µg/mL, Kitamura et al., 2003). Ishida et al.(2003) used anti-TGF-beta neutralizing antibodies at 10 µg/mL, which did not result in complete inhibition. A low concentration (2.5 µg/mL) of neutrallizing antibody could not inhibit tensile-stimulated up-regulation of OPG (Fig. 3Go). Analysis of these data suggests that the up-regulation of OPG by tensile force was partially dependent on TGF-beta.

Osteoclastogenesis from PBMCs was inhibited by the conditioned medium of PDL cells, and especially by the conditioned medium of PDL cells that had been subjected to tensile stimulation (Fig. 1Go). When PBMCs were incubated in the conditioned medium of PDL cells, the number of TRAP-negative cells increased (data not shown). In addition, there was no significant difference in the total number of attached cells between the samples (data not shown). Taken together, the conditioned medium of PDL cells might induce PBMCs to differentiate into a cell lineage other than osteoclasts, or it might maintain them as undifferentiated cells. OPG is well-known as an osteoclastogenesis inhibitory factor (Hofbauer et al., 2000). However, there are many contradictory reports about the effect of TGF-beta on osteoclastogenesis. Some researchers reported that TGF-beta induces osteoclastogenesis (Quinn et al., 2001; Ishida et al., 2002; Koseki et al., 2002; Wang et al., 2002), while others were unable to demonstrate an effect (Chenu et al., 1988; Murakami et al., 1998; Takai et al., 1998; Weitzmann et al., 2000). Karsdal et al.(2003) reported that transient exposure to TGF-beta induces osteoclastogenesis, but continuous exposure to TGF-beta abrogates osteoclastogenesis through down-regulation of RANK expression, and therefore RANK-RANK-L signaling is attenuated. In the present study, the addition of anti-TGF-beta antibodies to the conditioned medium released the inhibition of osteoclastogenesis by PBMCs that had been incubated with the conditioned medium of PDL cells (Fig. 1Go). TGF-beta might inhibit osteoclastogenesis from PBMCs directly, or it might inhibit osteoclastogenesis via up-regulation of OPG in PDL cells.

In this study, we discovered that the application of tensile force up-regulated OPG expression in PDL cells, and that the conditioned medium of such PDL cells did not induce osteoclastogenesis from PBMCs. The up-regulation of OPG by tensile force was, in part, dependent on TGF-beta. Periodontal ligament tissue from teeth showing occlusion would express OPG and TGF-beta, and maintain alveolar bone homeostasis. However, alveolar bone homeostasis might be compromised when occlusion of teeth is lost.


    ACKNOWLEDGMENTS
 
This work was supported by Grants-in-Aid for scientific research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (12671984 and 16390602).

Received for publication November 10, 2004. Revision received November 29, 2005. Accepted for publication January 13, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Basdra EK, Komposch G (1997). Osteoblast-like properties of human periodontal ligament cells: an in vitro analysis. Eur J Orthod 19:615–621.[Abstract]
  • Bellows CG, Melcher AH, Aubin JE (1982). Association between tension and orientation of periodontal ligament fibroblasts and exogenous collagen fibres in collagen gels in vitro. J Cell Sci 58:125–138.[Abstract]
  • Chenu C, Pfeilschifter J, Mundy GR, Roodman GD (1988). Transforming growth factor beta inhibits formation of osteoclast-like cells in long-term human marrow cultures. Proc Natl Acad Sci USA 85:5683–5687.[Abstract/Free Full Text]
  • Cohn SA (1965). Disuse atrophy of the periodontium in mice. Arch Oral Biol 10:909–919.[Medline] [Order article via Infotrieve]
  • Cohn SA (1966). Disuse atrophy of the periodontium in mice following partial loss of function. Arch Oral Biol 11:95–105.[CrossRef][Medline] [Order article via Infotrieve]
  • Davidovitch Z, Nicolay OF, Ngan PW, Shanfeld JL (1988). Neurotransmitters, cytokines, and the control of alveolar bone remodeling in orthodontics. Dent Clin North Am 32:411–435.[Medline] [Order article via Infotrieve]
  • Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ, Riggs BL (2000). The roles of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone resorption. J Bone Miner Res 15:2–12.[CrossRef][Medline] [Order article via Infotrieve]
  • Horowitz MC, Xi Y, Wilson K, Kacena MA (2001). Control of osteoclastogenesis and bone resorption by members of the TNF family of receptors and ligands. Cytokine Growth Factor Rev 12:9–18.[CrossRef][Medline] [Order article via Infotrieve]
  • Ishida A, Fujita N, Kitazawa R, Tsuruo T (2002). Transforming growth factor-beta induces expression of receptor activator of NF-kappa B ligand in vascular endothelial cells derived from bone. J Biol Chem 277:26217–26224.[Abstract/Free Full Text]
  • Ishida S, Kinoshita T, Sugawara N, Yamashita T, Koike K (2003). Serum inhibitors for human mast cell growth: possible role of retinol. Allergy 58:1044–1052.[Medline] [Order article via Infotrieve]
  • Kaneda T, Nojima T, Nakagawa M, Ogasawara A, Kaneko H, Sato T, et al. (2000). Endogenous production of TGF-beta is essential for osteoclastogenesis induced by a combination of receptor activator of NF-kappa B ligand and macrophage-colony-stimulating factor. J Immunol 165:4254–4263.[Abstract/Free Full Text]
  • Kanzaki H, Chiba M, Shimizu Y, Mitani H (2002). Periodontal ligament cells under mechanical stress induce osteoclastogenesis by receptor activator of nuclear factor kappaB ligand up-regulation via prostaglandin E2 synthesis. J Bone Miner Res 17:210–220.[CrossRef][Medline] [Order article via Infotrieve]
  • Karsdal MA, Hjorth P, Henriksen K, Kirkegaard T, Nielsen KL, Lou H, et al. (2003). Transforming growth factor-beta controls human osteoclastogenesis through the p38 MAPK and regulation of RANK expression. J Biol Chem 278:44975–44987.[Abstract/Free Full Text]
  • Kitamura S, Maeshima Y, Sugaya T, Sugiyama H, Yamasaki Y, Makino H (2003). Transforming growth factor-beta 1 induces vascular endothelial growth factor expression in murine proximal tubular epithelial cells. Nephron Exp Nephrol 95:e79–e86.[CrossRef][Medline] [Order article via Infotrieve]
  • Koseki T, Gao Y, Okahashi N, Murase Y, Tsujisawa T, Sato T, et al. (2002). Role of TGF-beta family in osteoclastogenesis induced by RANKL. Cell Signal 14:31–36.[CrossRef][Medline] [Order article via Infotrieve]
  • Lekic P, McCulloch CA (1996). Periodontal ligament cell population: the central role of fibroblasts in creating a unique tissue. Anat Rec 245:327–341.[CrossRef][Medline] [Order article via Infotrieve]
  • Matsuda N, Morita N, Matsuda K, Watanabe M (1998). Proliferation and differentiation of human osteoblastic cells associated with differential activation of MAP kinases in response to epidermal growth factor, hypoxia, and mechanical stress in vitro. Biochem Biophys Res Commun 249:350–354.[CrossRef][Medline] [Order article via Infotrieve]
  • Murakami T, Yamamoto M, Ono K, Nishikawa M, Nagata N, Motoyoshi K, et al. (1998). Transforming growth factor-beta1 increases mRNA levels of osteoclastogenesis inhibitory factor in osteoblastic/stromal cells and inhibits the survival of murine osteoclast-like cells. Biochem Biophys Res Commun 252:747–752.[CrossRef][Medline] [Order article via Infotrieve]
  • Quinn JM, Itoh K, Udagawa N, Hausler K, Yasuda H, Shima N, et al. (2001). Transforming growth factor beta affects osteoclast differentiation via direct and indirect actions. J Bone Miner Res 16:1787–1794.[CrossRef][Medline] [Order article via Infotrieve]
  • Saito M, Saito S, Ngan PW, Shanfeld J, Davidovitch Z (1991). Interleukin 1 beta and prostaglandin E are involved in the response of periodontal cells to mechanical stress in vivo and in vitro. Am J Orthod Dentofacial Orthop 99:226–240.[Medline] [Order article via Infotrieve]
  • Shimizu N, Yamaguchi M, Goseki T, Ozawa Y, Saito K, Takiguchi H, et al. (1994). Cyclic-tension force stimulates interleukin-1 beta production by human periodontal ligament cells. J Periodontal Res 29:328–333.[CrossRef][Medline] [Order article via Infotrieve]
  • Takai H, Kanematsu M, Yano K, Tsuda E, Higashio K, Ikeda K, et al. (1998). Transforming growth factor-beta stimulates the production of osteoprotegerin/osteoclastogenesis inhibitory factor by bone marrow stromal cells. J Biol Chem 273:27091–27096.[Abstract/Free Full Text]
  • Troen BR (2003). Molecular mechanisms underlying osteoclast formation and activation. Exp Gerontol 38:605–614.[CrossRef][Medline] [Order article via Infotrieve]
  • Tsuji K, Uno K, Zhang GX, Tamura M (2004). Periodontal ligament cells under intermittent tensile stress regulate mRNA expression of osteoprotegerin and tissue inhibitor of matrix metalloprotease –1 and –2. J Bone Miner Metab 22:94–103.[CrossRef][Medline] [Order article via Infotrieve]
  • Udagawa N (2002). Mechanisms involved in bone resorption. Biogerontology 3:79–83.[CrossRef][Medline] [Order article via Infotrieve]
  • Wang R, Zhang L, Zhang X, Moreno J, Celluzzi C, Tondravi M, et al. (2002). Regulation of activation-induced receptor activator of NF-kappaB ligand (RANKL) expression in T cells. Eur J Immunol 32:1090–1098.[CrossRef][Medline] [Order article via Infotrieve]
  • Weitzmann MN, Cenci S, Haug J, Brown C, DiPersio J, Pacifici R (2000). B lymphocytes inhibit human osteoclastogenesis by secretion of TGFbeta. J Cell Biochem 78:318–324.[CrossRef][Medline] [Order article via Infotrieve]
  • Yamaguchi M, Shimizu N, Goseki T, Shibata Y, Takiguchi H, Iwasawa T, et al. (1994). Effect of different magnitudes of tension force on prostaglandin E2 production by human periodontal ligament cells. Arch Oral Biol 39:877–884.[CrossRef][Medline] [Order article via Infotrieve]
  • Yoshino H, Morita I, Murota SI, Ishikawa I (2003). Mechanical stress induces production of angiogenic regulators in cultured human gingival and periodontal ligament fibroblasts. J Periodontal Res 38:405–410.[Medline] [Order article via Infotrieve]

Journal of Dental Research, Vol. 85, No. 5, 457-462 (2006)
DOI: 10.1177/154405910608500512


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Kanzaki, H.
Right arrow Articles by Mitani, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanzaki, H.
Right arrow Articles by Mitani, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?