|
Sign In to gain access to subscriptions and/or personal tools.
|
Biomaterials & Bioengineering |
Effects of a Hydroxyapatite-based Biomaterial on Gene Expression in Osteoblast-like Cells
P. Sibilla1,2,
A. Sereni1,
G. Aguiari1,
M. Banzi1,
E. Manzati1,
C. Mischiati1,
L. Trombelli2 and
L. del Senno1,*
1 Department of Biochemistry and Molecular Biology and
2 Research Center for the Study of Periodontal Diseases, University of Ferrara, Via L. Borsari 46, 44100 Ferrara, Italy
Correspondence: * corresponding author, sen{at}unife.it
 |
ABSTRACT
|
|---|
Biostite® is a hydroxyapatite-derived biomaterial that is used in periodontal and bone reconstructive procedures due to its osteoconductive properties. Since the molecular effects of this biomaterial on osteoblasts are still unknown, we decided to assess whether it may specifically modulate osteoblast functions in vitro. We found that a brief exposure to Biostite® significantly reduced the proliferation of MG-63 and SaOS-2 osteoblast-like cells to ~ 50% of the plateau value. Furthermore, gene array analysis of MG-63 cells showed that Biostite® caused a differential expression of 37 genes which are involved in cell proliferation and interaction, and related to osteoblast differentiation and tissue regeneration. Results were confirmed by RT-PCR, Western blot, and by an increase in alkaline phosphatase (ALP) specific activity. Biostite® also increased levels of polycystin-2, a mechano-sensitive Ca2+ channel, a promising new marker of bone cell differentiation. Biostite®, therefore, may directly affect osteoblasts by enhancing chondro/osteogenic gene expression and cytoskeleton-related signaling pathways, which may contribute to its clinical efficacy.
Key Words: hydroxyapatite-based biomaterial cell proliferation gene expression profile osteoblasts biomaterial gene expression polycystin-2
 |
INTRODUCTION
|
|---|
Some bone-regenerative strategies require the use of biomaterials to initialize the formation of new tissue (Froum et al., 2002). The osteoconductive properties and biocompatibility of hydroxyapatite have been demonstrated in the periodontal and orthopedic treatment of bone defects (Benqué et al., 1985). Collagen is also a good substrate for osteoblast growth and proliferation (Uemura et al., 2003), and biomaterials based on hydroxyapatite and collagen have consistently yielded more satisfactory results in terms of cell proliferation and matrix protein synthesis than have materials containing hydroxyapatite alone (Serre et al., 1993). Nevertheless, whether, and to what extent, these materials stimulate the appropriate intracellular biosynthesis at the molecular level is still under investigation.
Recently, Biostite®—a new biomaterial composed of synthetic hydroxyapatite, Type I collagen, and chondroitin sulphate—has been introduced to promote periodontal regeneration and bone formation. The material has proved to be highly biocompatible and osteoconductive (Benqué et al., 1985; Serre et al., 1993), as well as actively re-absorbable (Parodi et al., 1996). Clinical studies have shown favorable effects of Biostite® in improving attachment and probing depth when used for the treatment of intra-osseous defects (Scabbia and Trombelli, 2004).
To understand the molecular mechanisms responsible for these clinical results, we assessed the biological effects of Biostite® on two human osteoblast-like cell lines, MG-63 and SaOS-2, in vitro. These cell lines were selected because they exhibit several fundamental osteoblast characteristics (Anderson et al., 1998; Clover and Gowen, 1994) and therefore represent widely used and well-accepted models for osteoblasts in vitro. The effects on proliferation of these cells were first examined, and then specific changes in the gene expression profile in response to the biomaterial were investigated.
 |
MATERIALS & METHODS
|
|---|
Materials
Biostite® (Vebas s.r.l., S. Giuliano Milanese, Italy) is a mixture of synthetic hydroxyapatite (88%), equine Type I collagen (9.5%), and chondroitin sulphate (2.5%) (Scabbia and Trombelli, 2004).
Cell Culture and Proliferation Analysis
MG-63 and SaOS-2 osteosarcoma cells were cultured in minimal essential medium (MEM) with 10% fetal bovine serum (FBS), as previously described (Lambertini et al., 2002). Biostite® was frozen in liquid nitrogen, pulverized in a micro-dismembrator (Braun, Melsungen, Germany), suspended in medium, then added at different concentrations (from 2.5 to 2500 µg/mL) and times (from 1 to 6 days) to cells previously seeded in either 24-well plates or flasks. The medium was replaced every 2 days. Soluble factors deliverable from Biostite® were assessed in MG-63 cells: The powder was incubated in medium for 24 hrs, then the 0.2-micron filtered medium (conditioned medium) and unfiltered powder were added to the cultures. Trypan-blue-treated cells were counted directly in a Burker chamber at days 1, 2, 3, and 6.
RNA Extraction, Macro-array Analysis, and RT-PCR
Total RNA was extracted from MG-63 cells cultured for 48 hrs, with and without Biostite® (500 µg/mL), in duplicate, and with cells used between passages 5 and 6 after being thawed. Total RNA was extracted with TRIzol reagent (Invitrogen SRL, S. Giuliano Milanese, Italy). RNA from different experiments was pooled and stored in aliquots at –80°C.
Gene expression analysis was performed with the use of Atlas Human Cancer (Clontech, Palo Alto, CA, USA; cat. 7742-1) and Cell Interaction (cat. 7746-1) cDNA expression arrays, containing 588 and 265 genes, respectively, which are implicated in cell growth, differentiation, and interaction, and thus are putatively involved in the response to Biostite®.
Single-strand 32P-labeled cDNA probes were synthesized from 5 µg of total RNA by means of the Atlas Pure kit (Clontech). Filter hybridizations were performed according to the AtlasTM gene array kit protocols and reagents, as detailed in the APPENDIX. Video-imaging of hybridized filters was performed with a Molecular Analyst GS670 phosphorimager (BIO-RAD Laboratories, Hertford, UK), and array data were quantified with the ATLAS IMAGE 2.7 analysis software (Clontech). Micro-array data were obtained in conformity with the MIAME standards required for data publication (Brazma et al., 2001).
For RT-PCR analysis, 5 µg of RNA was reverse-transcribed according to ImProm-IITM Reverse Transcriptase Promega (Promega Italia, Milan, Italy) standard procedures. PCR was performed with primers co-amplifying cDNA for β-actin (F, 5'TGACGGGGTCA CCCACACTGTGCCCATCTA3'; R, 5'CTAGAAGCATTTGCGG TGGACGATGGAGGG3'), with either osteonectin (F, 5'ACAT GGGTGGACACGG3'; R, 5'CCAACAGCCTAATGTGAA3') or tenascin (R, 5'GAGATTTAGCCGTGTCTGAGGTTG3'; F, 5'GCCATCCAGGAGAGATTGAAGC3') and plasminogen activator inhibitor-1 (PAI1) (F, 5'GCTGGTCCATGGTTT CATGC3'; R, 5'TCCAGGATGTTCGTAGTAACGGC3'), via the Pfu DNA Polymerase system (Promega) under the following conditions: denaturation at 95°C for 5 min, annealing at 62°C for 45 sec, and elongation at 72°C for 60 sec for 27 cycles.
Western Blot Analysis and Alkaline Phosphatase Activity
MG-63 cells, cultured for 72 hrs with and without Biostite® (500 µg/mL), were treated and analyzed as previously described (Aguiari et al., 2004). Membranes with 10–50 µg of proteins were probed with anti-bone morphogenetic protein 8 (BMP-8), anti-Nuclear Factor B p65 (NF- B), and anti-β-actin primary antibodies (Santa Cruz Biotechnology, CA, USA), and then with anti-IgG secondary antibodies linked to horseradish peroxidase (Pierce Biotechnology, Rockford, IL, USA). Electrophoretic bands were analyzed by a densitometer (Bio-Rad Laboratories S.r.l., Segrate, Mi, Italy).
Alkaline phosphatase activity (ALP) was measured in cultured cells by hydrolysis of p-nitrophenylphosphate and expressed as U/mg protein, as previously described (Lambertini et al., 2002).
Statistical Analysis
The results were statistically analyzed by ANOVA. Post hoc multiple comparisons were performed to assess comparisons within and between groups. P value of < 0.05 represented a significant difference.
 |
RESULTS
|
|---|
Biostite® Transiently Reduces Cell Proliferation
Dose-response studies demonstrated that Biostite® caused a statistically significant decrease in MG-63 and SaOS-2 cell proliferation after 48 and 72 hrs of incubation (Fig. 1A ). Significant differences from baseline values were detected for both cell lines at Biostite® concentrations of 250 µg/mL or greater (P < 0.001 and < 0.01 in MG-63 after 48 and 72 hrs, respectively; P < 0.01 in SaOS-2 after both 48 and 72 hrs, respectively). Percentages of non-viable trypan-blue-stained cells were similar in treated and untreated control cells (data not shown), thus suggesting a limited effect of Biostite® on cell viability.

View larger version (26K):
[in this window]
[in a new window]
|
Figure 1. Time- and dose-dependent reduction in proliferation of Biostite®-treated cells. (A) SaOS-2 (open bars) and MG-63 (patterned bars) cell lines were plated at 2 x 106 and 3 x 104/mL, respectively, and, after 24 hrs, exposed to increasing Biostite® concentrations, as described in the METHODS section. After 48 and 72 hrs of treatment, cells were counted. Data represent the mean ± SEM obtained in a triplicate experiment run in duplicate (N = 6). Results indicate a significant dose-dependent decrease in cell counts at 48 hrs (F = 9.5, P > 0.01 for SaOS-2; F = 48.6, P > 0.001 for MG-63) and 72 hrs (F = 27.4, P > 0.001 for SaOS-2; F = 42.7, P > 0.001 for MG-63) for both cell lines. Asterisks over the bars indicate significant differences with respect to baseline (0) values (*P < 0.05; **P < 0.01; ***P < 0.001). Symbols ( ) between bars indicate significant variations between concentrations ( P < 0.05;  P < 0.01;   P < 0.001). (B) MG-63 cells were cultured for 48 hrs in the presence of Biostite® concentrations in powder form (diamonds) and its conditioned medium (triangles). Data represent the mean ± SEM (N = 6). A dose-dependent decrease in cell count is evident for both Biostite® forms. Asterisks indicate significant differences with respect to baseline (0) values (*P < 0.05; **P < 0.01). (C) MG-63 cells (plated at 1 x 104/mL and grown as in A) were cultured in the presence of 500 µg/mL of Biostite® and counted at baseline (0), and after 1, 2, 3, and 6 days of treatment. Solid symbols/bars represent Biostite®-treated cells, open symbols/bars represent untreated control cells. Data represent the mean ± SEM (N = 6). Differences in cell counts were statistically significant between groups at days 1, 2, and 3 of treatment, but not at day 6. Asterisks indicate significant differences between groups at each observation interval (*P < 0.05; **P < 0.01; ***P < 0.001, ANOVA).
|
|
Since similar effects were observed in both cell lines, the following experiments were performed with MG-63 cells only.
A significant dose-dependent reduction in cell count was observed in MG-63 cells after 48 hrs of incubation with either the powder form of Biostite® (from 200 to 800 µg/mL) (F = 31.1, P < 0.001) or its conditioned medium (F = 8.5, P < 0.05) (Fig. 1B ). The powder form caused a greater decrease in cell proliferation compared with the conditioned medium, with a reduction of 68% for the powder and 37% for the conditioned medium at 800 µg/mL (P < 0.001).
MG-63 cells, cultured with or without 500 µg/mL of Biostite®, were evaluated at baseline (0), and after 1, 2, 3, and 6 days of treatment. Differences in cell numbers were statistically significant between groups at days 1, 2, and 3 of treatment, with the Biostite®-treated cells showing a smaller proliferation trend compared with the untreated controls. At day 6, a similar number of cells was detected in the 2 groups (Fig. 1C ).
Biostite® Modulates Osteoblast Function
In MG-63 cells, Biostite® caused differences in expression in 37 out of 142 evaluated genes: 58 of 588 and 85 of 265 total genes in the "Cancer" and "Cell Interaction" arrays, respectively (APPENDIX Table). In the "Cancer" array, 6 genes (7%) were up-regulated and 10 (12%) down-regulated (Fig. 2 inset). In the "Cell Interaction" array, 15 (26%) were up-regulated and 8 (14%) down-regulated. Eleven genes were similarly expressed in both arrays, including β-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) housekeeping genes, which were both similarly modulated.

View larger version (46K):
[in this window]
[in a new window]
|
Figure 2. Genes differentially expressed in response to Biostite®. MG-63 cells (3 x 104/mL) were seeded in T175 flasks and cultured for 48 hrs with and without Biostite® (500 µg/mL) (n = 3 for treated and control cells). RNA extraction, purification, 32P-labeled cDNA synthesis and hybridization conditions were detailed in the METHODS section and in the APPENDIX. Expressed genes in Cancer (black bars) and Cell interaction (patterned bars) arrays are defined as up-regulated and down-regulated when expression levels showed more than a two-fold increase and reduction, respectively, after treatment, compared with untreated controls. Relative values were averaged for the results obtained in two hybridization experiments (see METHODS/APPENDIX for technical details). The number of genes affected by Biostite® is shown with respect to the expressed genes which were detected in each array (inset).
|
|
The genes for the extracellular matrix proteins collagen 16 1 and tenascin were markedly up-regulated. Fibronectin and laminin genes were not modulated, but those for their receptors (integrin β8 and 6, respectively) were up-regulated. The expression of the gene for integrin β2 receptor, cytohesin-1 (Sendide et al., 2005), as well as the expression of genes for Rho-related GTPases and associated regulators involved in actin/cytoskeleton organization and Rho-mediated signaling (Settleman, 1999), were increased. The increase in tissue-type plasminogen activator gene expression correlated with the reduction in its inhibitor (Plasminogen activator inhibitor-1, PAI1). Among growth factors, the vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) genes were up-regulated.
Proliferating cyclic nuclear antigen and growth arrest/DNA-damage-inducible p153 genes were markedly down- and up-regulated, respectively.
RT-PCR analysis (Fig. 3 ) confirmed variations shown by gene arrays, indicating that Biostite® markedly reduced PAI1 and increased osteonectin and tenascin RNA levels.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 3. RT-PCR analysis of Biostite®-modulated genes. Plasminogen activator inhibitor-1 (PAI1), tenascin, and osteonectin RNA levels in MG-63 cells exposed for 48 hrs to 500 µg/mL of Biostite® (+). RT-PCR products were subjected to electrophoresis on 2% agarose gel and visualized by UV exposure. A representative analysis is shown on the left. The level of specific bands was normalized for the β-actin cDNA content, and the results from three experiments are shown on the right as mean values ± SEM of controls (open bars) and treated cells (patterned bars) (*P < 0.05; **P < 0.01; ***P < 0.001, ANOVA). Similar results have been obtained by normalization with respect to GAPDH cDNA (data not shown).
|
|
Gene expression related to bone differentiation and proliferation was also examined in MG-63 cells at the protein level (Fig. 4A ). Biostite® markedly reduced the NF- B p65 protein, a transcription factor involved in cell proliferation and apoptosis, and increased the expression of bone marker BMP-8.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 4. Biostite® modulates protein levels and differentiation. (A) Western blot analysis of MG-63 cells treated with (+) and without (-) Biostite® (500 µg/mL) for 72 hrs. Total cell lysates (50 µg) were subjected to electrophoresis on 4-12% gradient PAGE and transferred to filters probed with antibodies against polycystin-2, NF- B, BMP-8, and β-actin. Polycystin-2 expression levels were normalized for the β-actin levels and expressed as ratios of O.D. arbitrary units. Bars express mean values ± SEM (n = 4). A significant increase in polycystin-2 levels was observed in Biostite®-treated cells (patterned bars), as compared with controls (open bars) (*p < 0.05, ANOVA). (B) ALP activity in MG-63 cells cultured with and without Biostite® (500 µg/mL) for 24 and 72 hrs. ALP activity was determined colorimetrically, corrected for the lysate protein content measured according to Bradford, and expressed as Units/mg protein. Bars express mean values ± SEM of results from three experiments. A significant increase in ALP was observed in Biostite®-treated cells (patterned bars) compared with controls (open bars) (**p < 0.01, ANOVA).
|
|
Polycystin-2, a recently described Ca2+-regulated cationic channel, was also significantly (~ three-fold) increased (polycystin-2 relative content: 0.62 ± 0.6 in controls vs. 1.96 ± 0.9 in treated cells, P < 0.05).
Biostite® increased ALP activity (Fig. 4B ), suggesting a biomaterial-dependent stimulation of bone cell differentiation.
 |
DISCUSSION
|
|---|
The present study demonstrates that exposure of MG-63 cells to Biostite® in vitro enhances chondro/osteogenic gene expression associated with a reduction in cell proliferation. This effect occurs without cell death, but causes a delay in the cell cycle required for cell attachment and adhesion. The enhanced gene expression is also partially mediated by the micro-mechanical properties of the biomaterial, demonstrated by the powder-mediated reduction being greater than that caused by filterable factors released from the powdered biomaterial, e.g., inorganic ions, carbohydrates, or peptides. Since Biostite® also reduces cell proliferation in SaOS-2 cells, it may affect the expression of genes involved in the proliferation of both cell lines. The down-regulation of the Proliferating Cyclic Nuclear Antigen and up-regulation of Growth Arrest Protein153 genes in MG-63 cells may account for the decreased cell growth.
Gene expression profiling clearly indicates the role of Biostite® in cell differentiation, as confirmed by the Biostite®-mediated increase in ALP activity, an early marker of osteoblast differentiation (Ozawa and Kasugai, 1996), and the decrease in NF- B, previously observed during osteoblast development (Deyama et al., 2001). The up-regulation of matrix protein genes like osteonectin, tenascin, and collagens alpha 6 and 16 may also suggest an effect of Biostite® on extracellular matrix formation during bone growth and mineralization in vivo. Tenascin has, in fact, already been reported to stimulate osteoblast differentiation and the maintenance of a functional state (Mackie and Ramsey, 1996).
Regarding the anomalous expression of collagen genes, it should be noted that collagen 6 precedes collagen 1 accumulation (Harumiya et al., 2002). Furthermore, collagen 16 is incorporated into supra-structural aggregates (Kassner et al., 2003), such as those including fibrillin, at the junction between cartilage and bone in the areas with intense osteoblastic activity (Plantin et al., 2000). Thus, Biostite® may modulate collagen expression in the early differentiation phase, and may contribute to tissue structural integrity by regulating assembly processes occurring during embryo development and wound-healing processes. Notably, since MG-63 cells exhibit characteristics of an early osteoblast (Clover and Gowen, 1994), it is likely that Biostite® activates stage-specific gene expression, which suggests early osteoblast differentiation.
Biostite® may also play a role in bone remodeling, as suggested by the up-regulation of matrix metalloproteinase 14, a membrane gelatinase expressed during in vitro osteoblast differentiation (Filanti et al., 2000), and of tissue-type plasminogen activator, an important neutral proteinase in bone development and remodeling (Davis et al., 1998).
The up-regulation of genes for potent angiogenic inducers, like VEGF and bFGF, acting synergistically in vivo and in vitro (Tille and Pepper, 2002), suggests that in vivo Biostite® effects may also result from an increase in the vascular system. VEGF, in fact, increases in response to alterations in extracellular environment (Spector et al., 2001), and is important in the regulation of bone remodeling and osteoblast differentiation (Mayr-Wohlfart et al., 2002).
Several members of the TGF-β superfamily are actively involved in bone fracture healing (Sykaras and Opperman, 2003). Thus, the BMP-8 increase in Biostite®-exposed cells supports its role when re-absorption of calcified cartilage and osteoblastic recruitment occurs.
Identification of the effects of hydroxyapatite-derived Biostite® on gene expression in human osteoblast-like cells supports the putative osteoconductive properties of the biomaterial via a decrease in cell proliferation and enhancement in cell functions favoring osteoblast differentiation. Reductions in the proliferation and differentiation of osteoblasts are known to be induced by surface roughness (Lincks et al., 1998), and it is noteworthy that Biostite® up-regulated and down-regulated CD9 antigen and basigin genes, respectively. These genes were found to be similarly modulated in an array analysis of roughness response genes in titanium-exposed osteoblasts, obtained from a primary culture of alveolar bone cells (Brett et al., 2004). It may be speculated, therefore, that Biostite®-induced gene modulation is partly attributed to the surface geometry of the biomaterial.
Expression of genes with unreported functions in osteoblasts was also noted. In treated cells, an increase in polycystin-2—a recently reported cationic channel with putative roles in Ca2+ signaling, cytoskeleton interactions, and cell differentiation (Sutters and Germino, 2003)—was demonstrated. The increase in polycystin-2, approximately three-fold, was likely to have been even greater if protein levels had been normalized to the DNA content, which is probably lower in growth-affected Biostite®-treated cells.
Interestingly, polycystin-2 is localized in the stem and basal body of the primary cilium, an organelle involved in the flow- and mechano-sensory signaling associated with cilium bending and a rise in intracellular Ca2+. Osteocytes have primary cilia (Whitfield, 2003), and the flow of interstitial fluid is thought to be implicated in the transfer of information about mechanical loading to bone cells (Cowin et al., 1995). Thus, the Biostite®-induced increase in polycystin-2 may also characterize the observed differentiation in terms of mechano-sensory and cytoskeletal mechanisms, thereby providing evidence for a role of polycystin-2 in osteoblast differentiation. Moreover, up-regulation of other cytoskeleton-associated genes, like Rho-GAP and cytohesin-1, which play an important role in cell growth and dynamics (Settleman, 1999; Sendide et al., 2005) but have not yet been studied in osteoblasts, may be targeted for further investigation in vitro and in vivo.
In conclusion, this study enabled us to profile the expression of genes involved in molecular pathways mediating Biostite®-induced signaling during the early osteoblastic differentiation of human osteoblast-like cells. While no immediate clinical relevance can be drawn from these in vitro studies, molecular mechanisms elicited by Biostite® warrant further investigation in other model systems in the hope of finding novel molecular targets and developing new therapeutic approaches to promoting bone formation.
 |
ACKNOWLEDGMENTS
|
|---|
The project was supported by Italian Telethon (E 1250), PRIN 2002 and CaRiFe grants to LdS, the Research Center for the Study of Periodontal Disease (Grant ex 60% 2002), Ferrara University, and Vebas s.r.l., S. Giuliano Milanese, Italy, and revision of the text was carried out by Anna Forster.
 |
FOOTNOTES
|
|---|
A supplemental appendix to this article is published electronically only at http://www.dentalresearch.org.
Received for publication August 5, 2004.
Revision received October 25, 2005.
Accepted for publication November 16, 2005.
 |
REFERENCES
|
|---|
- Aguiari G, Banzi M, Gessi S, Cai Y, Zeggio E, Manzati E, et al. (2004). Deficiency of polycystin-2 reduces Ca2+ channel activity and cell proliferation in ADPKD lymphoblastoid cells. FASEB J 18:884–886.[Abstract/Free Full Text]
- Anderson HC, Hsu HHT, Raval P, Reynold PR, Gurley DJ, Aguilera MX, et al. (1998). Bone-inducing agent in Saos-2 cell extracts and secretions. Cells Mater 8:89–98.
- Benqué EP, Gineste M, Heughebaert M (1985). Histological study of the biocompatibility of hydroxyapatite crystals in periodontal surgery. J Biol Buccale 13:271–282.[Medline]
[Order article via Infotrieve]
- Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, et al. (2001). Minimum information about a microarray experiment (MIAME)—toward standards for microarray data. Nat Genet 29:365–371.[CrossRef][Medline]
[Order article via Infotrieve]
- Brett PM, Harle J, Salih V, Mihoc R, Olsen I, Jones FH, et al. (2004). Roughness response genes in osteoblasts. Bone 35:124–133.
- Clover J, Gowen M (1994). Are MG-63 and HOS TE85 human osteosarcoma cell lines representative models of the osteoblastic phenotype? Bone 15:585–591.
- Cowin SC, Weinbaum S, Zeng Y (1995). A case for bone canaliculi as the anatomical site of strain generated potentials. J Biomech 28:1281–1297.[CrossRef][Medline]
[Order article via Infotrieve]
- Davis BA, Sipe B, Gershan LA, Fiacco GJ, Lorenz TC, Jeffrey JJ, et al. (1998). Collagenase and tissue plasminogen activator production in developing rat calvariae: normal progression despite fetal exposure to microgravity. Calcif Tissue Int 63:416–422.[CrossRef][Medline]
[Order article via Infotrieve]
- Deyama Y, Takeyama S, Suzuki K, Yoshimura Y, Nishikata M, Matsumoto A (2001). Inactivation of NF-kappaB involved in osteoblast development through interleukin-6. Biochem Biophys Res Commun 282:1080–1084.[CrossRef][Medline]
[Order article via Infotrieve]
- Filanti C, Dickson GR, Di Martino D, Ulivi V, Sanguineti C, Romano P, et al. (2000). The expression of metalloproteinase-2, -9, and -14 and of tissue inhibitors-1 and -2 is developmentally modulated during osteogenesis in vitro, the mature osteoblastic phenotype expressing metalloproteinase-14. J Bone Miner Res 11:2154–2168.
- Froum SJ, Gomez C, Breault MR (2002). Current concepts of periodontal regeneration. A review of the literature. NY State Dent J 68:14–22.
- Harumiya S, Gibson MA, Koshihara Y (2002). Antisense suppression of collagen VI synthesis results in reduced expression of collagen I in normal human osteoblast-like cells. Biosci Biotechnol Biochem 66:2743–2747.[Medline]
[Order article via Infotrieve]
- Kassner A, Hansen U, Miosge N, Reinhardt DP, Aigner T, Bruckner-Tuderman L, et al. (2003). Discrete integration of collagen XVI into tissue-specific collagen fibrils or beaded microfibrils. Matrix Biol 22:131–143.[CrossRef][Medline]
[Order article via Infotrieve]
- Lambertini E, Penolazzi L, Sollazzo V, Pezzetti F, de Mattei M, del Senno L, et al. (2002). Modulation of gene expression in human osteoblasts by targeting a distal promoter region of human estrogen receptor-alpha gene. J Endocrinol 172:683–693.[Abstract]
- Lincks J, Boyan BD, Blanchard CR, Lohmann CH, Liu Y, Cochran DL, et al. (1998). Response of MG63 osteoblast-like cells to titanium and titanium alloy is dependent on surface roughness and composition. Biomaterials 19:2219–2232.
- Mackie EJ, Ramsey S (1996). Modulation of osteoblast behavior by tenascin. J Cell Sci 109(Pt 6):1597–1604.[Abstract]
- Mayr-Wohlfart U, Waltenberger J, Hausser H, Kessler S, Gunther KP, Dehio C, et al. (2002). Vascular endothelial growth factor stimulates chemotactic migration of primary human osteoblasts. Bone 30:472–477.
- Ozawa S, Kasugai S (1996). Evaluation of implant materials (hydroxyapatite, glass-ceramics, titanium) in rat bone marrow stromal cell culture. Biomaterials 17:23–29.
- Parodi R, Santarelli G, Carusi G (1996). Application of slow-resorbing collagen membrane to periodontal and peri-implant guided tissue regeneration. Int J Periodont Rest Dent 16:174–185.
- Plantin P, Durigon M, Boileau C, Le Parc J (2000). Fibrillin network in normal bone tissue [article in French]. Ann Pathol 20:115–118.[Medline]
[Order article via Infotrieve]
- Scabbia A, Trombelli L (2004). A comparative study on the use of a HA/collagen/chondroitin sulphate biomaterial (Biostite) and a bovine-derived HA xenograft (Bio-Oss) in the treatment of deep intra-osseous defects. J Clin Periodontol 31:348–355.[Medline]
[Order article via Infotrieve]
- Sendide K, Reiner NE, Lee JS, Bourgoin S, Talal A, Hmama Z (2005). Cross-talk between CD14 and complement receptor 3 promotes phagocytosis of mycobacteria: regulation by phosphatidylinositol 3-kinase and cytohesin-1. J Immunol 174:4210–4219.[Abstract/Free Full Text]
- Serre CM, Papillard M, Chavassieux P, Boivin G (1993). In vitro induction of a calcifying matrix by biomaterials constituted of collagen and/or hydroxyapatite: an ultrastructural comparison of three types of biomaterials. Biomaterials 14:97–106.
- Settleman J (1999). Rho GTPases in development. Prog Mol Subcell Biol 22:201–229.[Medline]
[Order article via Infotrieve]
- Spector JA, Mehrara BJ, Greenwald JA, Saadeh PB, Steinbrech DS, Bouletreau PJ, et al. (2001). Osteoblast expression of vascular endothelial growth factor is modulated by the extracellular microenvironment. Am J Physiol Cell Physiol 280:C72–C80.[Abstract/Free Full Text]
- Sutters M, Germino GG (2003). Autosomal dominant polycystic kidney disease: molecular genetics and pathophysiology. J Lab Clin Med 141:91–101.[CrossRef][Medline]
[Order article via Infotrieve]
- Sykaras N, Opperman LA (2003). Bone morphogenetic proteins (BMPs): how do they function and what can they offer the clinician? J Oral Sci 45:57–73.[Medline]
[Order article via Infotrieve]
- Tille JC, Pepper MS (2002). Mesenchymal cells potentiate vascular endothelial growth factor-induced angiogenesis in vitro. Exp Cell Res 280:179–191.[CrossRef][Medline]
[Order article via Infotrieve]
- Uemura T, Dong J, Wang Y, Kojima H, Saito T, Iejima D, et al. (2003). Transplantation of cultured bone cells using combinations of scaffolds and culture techniques. Biomaterials 24:2277–2286.
- Whitfield JF (2003). Primary cilium—is it an osteocytes strain-sensing flowmeter? J Cell Biochem 89:233–237.[CrossRef][Medline]
[Order article via Infotrieve]
Journal of Dental Research, Vol. 85, No. 4,
354-358 (2006)
DOI: 10.1177/154405910608500414

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati Twitter What's this?
|
|