| Sign In to gain access to subscriptions and/or personal tools. |
Phenotypic Variation in Dentinogenesis Imperfecta/Dentin Dysplasia Linked to 4q21![]()
1 University of Michigan School of Dentistry, 1011 North University, Ann Arbor, MI 48109-1078, USA; Correspondence: * corresponding author, Department of Orthodontics and Pediatric Dentistry, University of Michigan Dental Research Lab, 1210 Eisenhower Place, Ann Arbor, MI 48108, USA; janhu{at}umich.edu
Dentinogenesis imperfecta (DGI) and dentin dysplasia (DD) are allelic disorders that primarily affect the formation of tooth dentin. Both conditions are autosomal-dominant and can be caused by mutations in the dentin sialophosphoprotein gene (DSPP, 4q21.3). We recruited 23 members of a four-generation kindred, including ten persons with dentin defects, and tested the hypothesis that these defects are linked to DSPP. The primary dentition showed amber discoloration, pulp obliteration, and severe attrition. The secondary dentition showed either pulp obliteration with bulbous crowns and gray discoloration or thistle-tube pulp configurations, normal crowns, and mild gray discoloration. Haplotype analyses showed no recombination between three 4q21-q24 markers and the disease locus. Mutational analyses identified no coding or intron junction sequence variations associated with affection status in DMP1, MEPE, or the DSP portion of DSPP. The defects in the permanent dentition were typically mild and consistent with a diagnosis of DD-II, but some dental features associated with DGI-II were also present. We conclude that DD-II and DGI-II are milder and more severe forms, respectively, of the same disease.
Key Words: dentin dentin sialophosphoprotein DSPP dentinogenesis imperfecta dentin dysplasia
The clinical classification system that is often used to categorize inherited defects of tooth dentin was first proposed to make a distinction for a pattern of dentin defects, designated dentin dysplasia type II (DD-II), that featured "amber, translucent colouration and total pulpal obliteration in all primary teeth" and permanent teeth with "thistle-tube pulp configuration with ubiquitous pulp stones and normal colouration" (Shields et al., 1973). This classification system, now in use for over 30 years, divides inherited dentin defects into two disease groups: dentinogenesis imperfecta (DGI, types I–III) and dentin dysplasia (DD, types I and II). This system, however, was never intended "to be the final work on the etiologic classification of dentin diseases, about which little is known of the basic molecular defect" (Bixler, 1976). As more is known about the etiology of non-syndromic heritable dentin defects, the more they appear to be manifestations of a single disease. The distinctions used to compartmentalize the spectrum of phenotypic variations observed in kindreds with inherited defects of dentin into dentinogenesis imperfecta and dentin dysplasia may reflect differences in severity rather than in the presence, absence, or grouping of defined pathological features. DGI-I is the dental phenotype associated with osteogenesis imperfecta (OI) (Pallos et al., 2001). People with this disorder are best classified as having osteogenesis imperfecta with DGI (OI/DGI) (OConnell and Marini, 1999). Defects in the human dentin sialophosphoprotein (DSPP) gene can cause DGI-II (Xiao et al., 2001; Zhang et al., 2001; Kim et al., 2004, 2005), DGI-III (Dong et al., 2005; Kim et al., 2005), and DD-II (Rajpar et al., 2002). No mutation in any gene besides DSPP has been shown to cause non-syndromic heritable dentin defects. While it is premature to rule out a role for other genes, the hypothesis that only DSPP is involved in the etiology of DGI-II, DGI-III, and DD-II is consistent with the assertion that "heritable dentine defects can be viewed as a continuum" (Shields et al., 1973). We have characterized a four-generation kindred displaying inherited dentin defects associated with both DD-II and DGI-II (Witkop, 1975; Bixler, 1976). While the kinds of defects vary within our kindred, the severity of the defects is generally mild and most consistent with a diagnosis of dentin dysplasia type II. Pulp chamber obliteration occurs after eruption, and the dental phenotype does not lead to accelerated attrition of the permanent teeth. In this study, we describe the variations in dental phenotypes among affected members of this kindred, and investigate the genetic etiology by performing linkage and mutation analyses in the critical region of chromosome 4q21-q24.
Enrollment of Human Subjects The study protocol and patient consents were reviewed and approved by the Institution Review Boards at the University of Michigan. Twenty-three members of a four-generation kindred consented to participate in the study and contributed samples for genomic DNA analyses. Medical and dental histories and oral photographs were obtained for 17 family members (I-2; II-5, 6, 7, 8, 9, 11; III-4, 6, 7, 8, 9, 10, 11, 12; IV-1, 2). Dental radiographs were obtained from 14 of these members (excepting II-8, IV-1, IV-2). Partial previous dental records were obtained for five family members (II-8, II-9, III-9, III-10, III-11).
Primer Design, Polymerase Chain-reaction (PCR), and DNA Sequence Analyses
Oligonucleotide primers for polymerase chain-reaction (PCR) were designed with Primer3 on the Web (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) (Rozen and Skaletsky, 2000). The strategy was to generate PCR amplification products that would allow for the DNA sequencing of each coding exon and at least 50 bp of adjoining intron. The PCR conditions for the amplification of the coding regions of DSPP, DMP1, and MEPE, and the sequences of the PCR and DNA sequencing primers, are provided in the Table
We accomplished DNA sequence analysis of the DSPP 5'regulatory region by characterizing 3 overlapping PCR amplification products. The amplimers were 648, 667, and 640 bp in length and were amplified with the following primer pairs, respectively: PrF1 CTGCTTTAGTGACATCCCACAG and PrR1 GGAAATTTGCCTTGAAGCTG; PrF2 GCCCTTTAATCTGCCCAAGT and PrR2 CGTTGCC TGAGGGATCTTTA; and PrF3 GCACCTTT GGACATCTTGCT and PrR3 CCACTGTCCTGG ACTTTTGC.
Haplotype Analyses
Members of a Caucasian family with inherited defects of dentin were examined at a University of Michigan dental clinic. The family agreed to participate in this study, and DNA samples were obtained from 23 members of the kindred. There was no history of any unusual bone brittleness or unexplained hearing loss in the family. Affection status (the presence of inherited dentin defects) was ascertained by oral examination and analysis of dental radiographs.
The pedigree of the kindred going back 4 generations is shown in Fig. 1
In generation III, several classic features of inherited dentin defects were evident. Individual III-4 (age 30 yrs) had crowns of normal shape with a mildly gray coloration in some teeth (Fig. 1 Oral photographs of the two siblings in generation IV show the contrast between the normal primary teeth of individual IV-1 (age 3 yrs) and the affected primary teeth of individual IV-2 (age 2 yrs), which were amber in color and translucent. Although these were the only individuals with primary teeth that were examined, several family members recalled having primary teeth that resembled "popcorn kernels", that wore down to the level of the gingiva.
DNA samples were analyzed from 10 affected and 13 unaffected family members (N = 23). Haplotype analysis of these samples identified three markers, D4S1534, D4S1572, and D4S414, with statistically significant (> 3) LOD scores (Fig. 2
In our kindred affected with a mild form of non-syndromic inherited dentin defects, the primary dentition was amber and translucent, and showed an accelerated rate of attrition. The primary teeth were more severely affected than the permanent teeth. These features of the primary teeth, however, are common to all forms of inherited dentin defects and do not help make a more specific diagnosis. The presence of discoloration in both dentitions has been used to draw a distinction between dentin dysplasia and dentinogenesis imperfecta (Bixler, 1976), but the discoloration of the permanent dentition, while a consistent feature of DGI-II, has also been reported in patients with DD-II (Ranta et al., 1990; Salvolini et al., 1999). Several of our subjects (II-9, II-11, III-4) showed thistle-tube-shaped pulp chambers that are a classic feature of DD-II. Another subject (III-9) showed gray-colored anterior crowns having an ovoid or bulbous shape, with obliterated pulp chambers. Some posterior teeth had bulbous crowns with tapering roots. Bulbous crowns, tapered roots, and obliterated pulp chambers are more associated with DGI-II, but even in this subject the dental phenotype was not severe enough to sustain a diagnosis of DGI-II. The radiographic density of the dentin was within normal limits, as was the rate of attrition of the permanent teeth. A genetic region on the long arm of chromosome 4 that includes DSPP has been linked to both DGI-II (Crosby et al., 1995) and DD-II (Dean et al., 1997). One DSPP mutation (p.Y6D) has been shown to cause DD-II (Rajpar et al., 2002). Five DSPP coding mutations (p.A15V, p.P17T, p.V18F, p.Q45X, p.R68W) and two splice junction mutations (IVS2-3C and IVS3+1) have been shown to cause DGI-II (Xiao et al., 2001; Zhang et al., 2001; Kim et al., 2004, 2005; Malmgren et al., 2004). DSPP is a chimeric protein containing three structural domains. Dentin sialoprotein (DSP) is a proteoglycan at the N-terminus (Ritchie et al., 1994; Yamakoshi et al., 2005a); dentin glycoprotein (DGP) is in the middle (Yamakoshi et al., 2005b), and dentin phosphoprotein (DPP) is a highly phosphorylated protein at the C-terminus (Ritchie and Wang, 1996; MacDougall et al., 1997). The DSPP mutation (p.Y6D) that generated the mildest phenotype in the permanent dentition (DD-II) involved a single amino acid substitution in the DSPP signal peptide. This mutation likely reduced the amount of secreted DSPP protein by at most 50% and maybe much less, but the secreted proteins (DSP, DGP, and DPP) were entirely normal. The five DSPP coding mutations causing DGI-II were all in the DSP region. Four of these mutations caused single amino acid substitutions that would change the DSP primary structure, suggesting that this proteoglycan has a critical function in dentin formation. The fifth mutation created a translational stop codon that could have caused a small amount of truncated DSP to be secreted, but the main effect would be degradation of DSPP mRNA transcripts from the mutant allele. A similar degradation of transcripts was the expected result of the two splice junction mutations. Thus, the major predicted consequence of several of the DSPP mutations causing DGI-II was haploinsufficiency, or a reduction by half of the amount of DSPP secreted, while DD-II might be expected to have caused a reduction of less than half. The clinical evaluation of our kindred with DD-II shows that this phenotype overlaps that of DGI-II, and that all of the defining criteria to make the distinction between DD-II and DGI-II are based upon severity. The disease locus in our kindred lies in the 4q21-q24 region, which includes the DSPP gene. We were not able to analyze the DPP coding region, because its extreme redundancy precludes PCR mutational analyses. Furthermore, the wild-type sequence of the human DPP coding region is uncertain. At the time of this writing, the DSPP exon 5 genomic sequence (NC_000004) is 144 bp longer than the corresponding region of the DSPP cDNA reference sequence (NM_014208). The 144-bp difference is spread over an extensive region and requires 11 length adjustments varying between 9 and 63 dashes to maintain the alignment. Even with the length adjustments, there are 18 nucleotide mismatches. Our mutational analyses were able to exclude coding and splice junction mutations outside of the DPP region of DSPP, and the DMP1 and MEPE genes, which had previously been proposed as candidate genes (MacDougall et al., 1996, 2002). Analyses of known DSPP mutations indicate that when DSPP secretion is reduced by a little, DD-II is the resulting phenotype. When DSPP secretion is reduced by half, DGI-II is the phenotype. We conclude that the genetic and clinical evaluation of kindreds with inherited dentin defects are most consistent with the interpretation that type II dentin dysplasia and dentinogenesis imperfecta are the same disease, differing mainly in the severity of the underlying genetic defect and resulting clinical phenotype. Our findings support the need for a better understanding of the genetic etiologies of non-syndromic heritable dentin defects, so that the goal of instituting a gene-based classification system can be realized (Dean et al., 1997). A gene-based system would group all of the DD-II, DGI-II, and DGI-III cases that are associated with DSPP defects into a single category, and then make distinctions based upon severity. According to the same designations as are currently in use, the DD-II phenotype would be the least severe, DGI-II intermediate, and the DGI-III phenotype the most severe form of the disease.
We thank the affected family for their participation. This investigation was supported by the Foundation of the American Academy of Pediatric Dentistry (AAPD), the Michigan Delta Dental Fund, and USPHS Research Grant DE15846 from the National Institute of Dental and Craniofacial Research (NIDCR), National Institutes of Health (NIH), Bethesda, MD 29892, USA.
J.-W. Kim and M.L. Beattie made equal contributions and should both be considered as first author Received for publication March 4, 2005. Revision received November 9, 2005. Accepted for publication December 2, 2005.
Journal of Dental Research, Vol. 85, No. 4,
329-333 (2006) This article has been cited by other articles:
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


= 0) were observed between the disease locus and these three markers in the 10 affected persons tested. Mutational analyses were performed on genomic DNA from affected individual III-9. No sequence variations were identified in the splice junctions or within the first 4 exons or 5'part of DSPP or in the coding exons and adjoining introns of DMP1 and MEPE. Nor were any disease-associated sequence variations detected in the DSPP 5'transcriptional regulatory region. 
J.-W. Kim and M.L. Beattie made equal contributions and should both be considered as first author 

