|
Sign In to gain access to subscriptions and/or personal tools.
|
Dendritic-NK Cell Interactions in P. gingivalis-specific Responses
T. Kikuchi,
D.L. Willis,
M. Liu,
D.B. Purkall,
S. Sukumar,
S.E. Barbour,
H.A. Schenkein and
J.G. Tew*
Clinical Research Center for Periodontal Diseases, School of Dentistry, VCU, PO Box 980556, Richmond, VA 23298-0556, USA;
Correspondence: * corresponding author, tew{at}hsc.vcu.edu
 |
ABSTRACT
|
|---|
Patients with localized aggressive periodontitis have type-1 cytokines in gingival crevicular fluid and high titers of IFN- -dependent IgG2 reactive with P. gingivalis in gingival crevicular fluid and serum. Localized aggressive periodontitis monocytes spontaneously differentiate into dendritic cells that can stimulate IFN- production by NK cells. These relationships prompted the hypothesis that P. gingivalis-dendritic cell-NK cell interactions might promote type-1 cytokine responses. Although P. gingivalis is not a potent inducer of Th1 responses, it stimulated strong IL-12 responses by monocyte-derived dendritic cells in the presence of IFN- , and IFN- was produced by NK cells within 24 hrs in the presence of dendritic cells. Anti-P. gingivalis IgG2 responses were enhanced by dendritic cells, and removal of NK cells reduced IFN- - and P. gingivalis-specific IgG2. Thus, P. gingivalis-dendritic cell-NK cell interactions apparently resulted in reciprocal stimulation and increased type-1 cytokine production by both dendritic cells and NK cells, and increased P. gingivalis-specific IgG2.
Key Words: dendritic cells NK cells P. gingivalis IFN- IgG2
 |
INTRODUCTION
|
|---|
Porphyromonas gingivalis is frequently found in periodontal lesions and is thought to be a major etiologic agent of periodontitis (Haffajee and Socransky, 1994). Localized aggressive periodontitis begins in the circumpubertal period, and patients have type-1 cytokines in gingival crevicular fluid (Salvi et al., 1998) and high titers of IFN- -dependent IgG2 anti-P. gingivalis in gingival crevicular fluid and serum (Tew et al., 1985; Kawano et al., 1994). Anti-P. gingivalis is associated with decreased attachment loss, suggesting that P. gingivalis specific IgG plays a role in host defense (Gunsolley et al., 1987).
Dendritic cells, including Langerhans cells and dermal dendritic cells, are found in gingival tissue, and mature CD83+ dendritic cells are present in tissues from patients with periodontitis (Jotwani et al., 2001; Cirrincione et al., 2002; Jotwani and Cutler, 2003). Furthermore, dermal dendritic cells, which have similarities with monocyte-derived dendritic cells, may be associated with T-cells in periodontitis, suggesting dendritic-cell-mediated T-cell activation (Jotwani and Cutler, 2003). Recently, we reported that A. actinomycetemcomitans-stimulated dendritic cells promote a rapid IFN- response by stimulating NK cells (Kikuchi et al., 2004). Although NK cells are described as cytotoxic effectors, recent studies indicate that an immunoregulatory subset of NK cells responds to activation with cytokine secretion, and NK cell-dendritic cell interactions can also promote dendritic cell maturation (Cooper et al., 2004; Ferlazzo and Munz, 2004).
Dendritic cells spontaneously emerge in cultures of localized aggressive periodontitis monocytes, and monocyte-derived dendritic cells selectively promote IgG2 production (Barbour et al., 2002). These results prompted the hypothesis that the interface between immature dendritic cells and P. gingivalis might enhance IFN- production, and that IFN- might promote dendritic cell maturation, IL-12 production, immunopathology, as well as protective IgG2 (Tew et al., 1985; Kawano et al., 1994; Takeichi et al., 2000; Agostini et al., 2001; Brandtzaeg, 2001).
 |
MATERIALS & METHODS
|
|---|
Human Subjects
The Internal Review Board of Virginia Commonwealth University approved our use of human subjects, and informed patient consent was obtained from all study subjects. Subjects with a normal periodontium had no attachment loss other than gingival recession and no pockets greater than 3 mm. Chronic periodontitis subjects were > 25 yrs old with 2 mm attachment loss or greater on more than 1 tooth and no indication of juvenile onset. We used P. gingivalis-seropositive chronic periodontitis subjects to avoid spontaneous development of large numbers of dendritic cells in culture that enhance IFN- and IgG2.
Bacteria
P. gingivalis strain W83 was used and was grown as described previously (Kikuchi et al., 2004). Immune complexes of P. gingivalis were prepared by the incubation of 100 ng of anti-P. gingivalis per 106 organisms for 30 min, and then 106 organisms were added to each of the appropriate cultures.
PBL Cultures
Peripheral blood mononuclear cells (PBL) were obtained and cultured as described previously (Kikuchi et al., 2004). Monocytes were purified in a MoFlo (Cytomation, Fort Collins, CO, USA) cell sorter and then cultured in media enriched with 10% fetal calf serum with 500 U/mL of human IL-4 and 800 U/mL of human GM-CSF for 5 days, to generate monocyte-derived dendritic cells, or with 1000 U/mL of human M-CSF to generate macrophages (Kikuchi et al., 2004). Follicular dendritic cells were isolated from lymph nodes of adult mice, after irradiation to destroy lymphocytes and collagenase was used to help free follicular dendritic cells from the tissue and density gradients, to enrich follicular dendritic cells as described previously (Wu et al., 1996). VCUs Institutional Animal Care and Use Committee approved our use of mice for isolating follicular dendritic cells.
Magnetic Cell Separation
A magnetic cell separation system (Miltenyi Biotec GmbH, Bergisch-Gladbach, Germany) was used to separate NK cells. Peripheral blood mononuclear cells were incubated with antibodies against CD56 that had been conjugated directly to the Miltenyi microbeads. The PBL were loaded onto LS separation columns that were seated in a strong magnetic field. The labeled cells were trapped in the columns, and the cells in the effluent were used as NK-depleted. Then the columns were removed from the magnetic field, and the CD56-labeled cells were eluted and used (Kikuchi et al., 2004).
ELISA for Cytokines and Anti-P. gingivalis
IFN- , IL-4, IL-12p70, and IL-10 levels were measured with ELISA kits from R&D Systems (Minneapolis, MN, USA) and used according to the manufacturers instructions. Anti-P. gingivalis levels were determined as described previously (Califano et al., 1997, 1999).
IL-12p35, IL-12p40, and IL-10 mRNA Levels by Real-time Quantitative PCR
RNA was extracted with the use of TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), according to the manufacturers instructions. The iCycler (Bio-Rad, Hercules, CA, USA) was used with the TaqManTM one-step reverse-transcriptase-PCR master mix reagent kit (ABI, Foster City, CA, USA) for real-time quantitative PCR. The amplifications of IL-12p35, IL-12p40, IL-10, and 18S RNA were run in separate tubes with the same amount of RNA. Oligonucleotide sequences were determined, and experimental conditions were optimized for each target. The sequences for the various oligonucleotides—starting with the forward primer, followed by then reverse primer, then the probe, and going from 5' to 3'—were as follows: (IL-12 p35) TCAAAACATGCTGGCAGTTAT, GAAGAAGTATGCAG AGCTTGAT, HEX-AGCTGATGCAGGCCCTGAATTTCA-BHQ-1; (IL-12p40) CACAAAGGAGGCGAGGTT, TGGGTTC TTTCTGGTCCTTT, FAM-CCATTCGCTCCTGCTGCTT CACAA-BHQ-1; (IL-10) GAGAACCAAGACCCAGACATCAA, CACAAAGGAGGCGAGGTT, HEX-AGCTGATGCAGGCCC TGAATTTCA-BHQ-1; and (18s rRNA) AAAATTAGAGTGTTC AAAGCAGGC, CCTCAGTTCCGAAAACCAACAA, CY5-CGAGCCGCCTGGATACCGCAGC-BHQ-2. Reactions were prepared in 96-well PCR plates (Bio-Rad, Hercules, CA, USA) in a 25-µL medium containing: 10 ng of total RNA, 12.5 µL of 2x Master Mix without UNG, 0.625 µL of 40x MultiScribe and Rnase Inhibitor Mix, 250 nM of probe, and 900 nM of forward and reverse primers. Thermal cycling conditions consisted of an initial reverse transcription step at 48°C for 30 min, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C for IL-12p35, IL-12p40, and IL-10, respectively. The cycling conditions for 18S were 20 cycles of 15 sec at 95°C and 1 min at 60°C. Fold differences in mRNA expression levels were calculated according to the  CT method (Livak and Schmittgen, 2001).
Statistical Analysis
Experiments were repeated a minimum of 3 times, and cultures were done in triplicate. Group means were compared by ANOVA, followed by Tukeys correction for multiple comparisons. Significance was accepted at alpha less than 0.05.
 |
RESULTS
|
|---|
P. gingivalis-stimulated Dendritic Cells Induced a Rapid IFN- Response by PBL
Dendritic cells spontaneously emerge in monocyte cultures from localized aggressive periodontitis patients who also have high titers of IFN- -dependent IgG2 reactive with the serotype-specific antigens of P. gingivalis (Kawano et al., 1994; Califano et al., 1999; Barbour et al., 2002). We reasoned that P. gingivalis might stimulate IFN- production in PBL cultures, and that additional dendritic cells might enhance the IFN- response. The addition of P. gingivalis to PBL from subjects with a normal periodontium led to IFN- production within 24 hrs, and additional dendritic cells enhanced the IFN- response (Fig. 1 ). In marked contrast, the addition of macrophages depressed rather than enhanced IFN- production.
Requirement for CD56+ Cells (NK cells), Dendritic Cells, and IL-12 for Optimal Early IFN- Production
The ability of P. gingivalis to induce IFN- production within 24 hrs and the known ability of NK cells to respond rapidly (Kikuchi et al., 2004) prompted the hypothesis that NK cells might contribute to the IFN- response. Depletion of CD56+ cells from P. gingivalis-stimulated cultures prepared with PBL from subjects with a normal periodontium dramatically reduced the IFN- response (Fig. 2a ). Furthermore, P. gingivalis induced early IFN- production by positively selected CD56+ cells, and the addition of dendritic cells enhanced this response (Fig. 2b ). NK cells need IL-12 for optimal activity, and dendritic cells are an excellent source. The addition of anti-IL-12 inhibited the P. gingivalis-induced IFN- response (Fig. 2c ). NK cell involvement was further supported by experiments demonstrating that allogeneic dendritic cells stimulated with P. gingivalis could elicit potent IFN- responses, indicating a lack of MHC restriction (data not shown). Thus, CD56+ cells appear to be the source of early IFN- in PBL stimulated by P. gingivalis.
Effect of IFN- on Production of IL-10 and IL-12 by Dendritic Cells
It is known that dendritic cells can provide IL-12, but P. gingivalis or P. gingivalis-LPS are not potent IL-12 inducers when compared with organisms like E. coli (Jotwani et al., 2001, 2003; Kanaya et al., 2004) or A. actinomycetemcomitans (Kikuchi et al., 2004). However, NK cells enhance dendritic cell maturation, suggesting that NK-cell-derived IFN- might promote dendritic-cell-derived IL-12. To test this, we studied mRNA for IL-10 and IL-12 from dendritic cells prepared from subjects with a normal periodontium, stimulated with P. gingivalis in the presence and absence of IFN- , using real-time quantitative PCR. The addition of P. gingivalis increased the levels of IL-10 mRNA and dramatically increased IL-12p40 mRNA, but the levels of IL-12p35 mRNA were not increased (Table ). Adding IFN- to cultures with the P. gingivalis had no effect on IL-10 mRNA. However, IFN- increased IL-12p40 and substantially increased mRNA for IL-12p35. Furthermore, bioactive IL-12p70 levels dramatically increased when dendritic cells were stimulated with P. gingivalis plus IFN- , supporting reciprocal dendritic cell-NK cell activation.
Influence of NK Cells on P. gingivalis-specific IgG2 Responses
IgG2 reactive with serotype-specific antigens dominates anti-P. gingivalis responses, and IgG2 is IFN- -dependent (Califano et al., 1999). We reasoned that the addition of dendritic cells to PBL from seropositive chronic periodontitis subjects should increase IFN- and P. gingivalis-specific IgG2 responses, and that removing NK cells would reduce IFN- and inhibit P. gingivalis-specific IgG2 production. The addition of P. gingivalis-immune complexes to PBL from seropositive subjects induced recall IgG2 responses, and the addition of dendritic cells enhanced this response (Fig. 3A ). However, responses were low and frequently difficult to detect. Immune complexes form almost instantaneously upon secondary challenge in vivo and are trapped by follicular dendritic cells which present both antigens, to engage the B-cell receptor for antigen, and CD21L, to engage CD21 in the B-cell co-receptor complex (CD21/CD19/CD81) that enhances IgG production (Tew et al., 2001). The addition of follicular dendritic cells to these cultures induced a higher IgG2 anti-P. gingivalis response, and the addition of dendritic cells enhanced this response (Fig. 3A ).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3. Influence of dendritic cells and NK cells on IgG2 anti-P. gingivalis production. (A) PBL from a P. gingivalis (Pg)-seropositive subject with chronic periodontitis ± autologous dendritic cells (DC) and/or follicular dendritic cells (FDCs) were stimulated with 1 x 106 P. gingivalis-anti-P. gingivalis immune complex (Pg-ICs). After a six-day inductive period, the cells were washed to remove any free antigen or antibody, new culture media were added, and supernatant fluids were collected at 14 days. The IgG2 anti-P. gingivalis produced from days 6 to 14 was measured with the supernatant fluids. The data are recorded as the mean ± SE, and * indicates p < 0.05. These data are representative of 3 experiments of this type. (B) PBL from a P. gingivalis-seropositive chronic periodontitis subject or CD56+-depleted PBL from the same subject were held constant at 1 x 106 cells per culture ± follicular dendritic cells, and were stimulated with 1 x 106 P. gingivalis-anti-P. gingivalis immune complexes. Supernatant fluids were collected at 14 days as described above, and IgG2 anti-P. gingivalis production was measured. The data are recorded as the mean ± SE, and * indicates p < 0.05. These data are representative of 3 experiments of this type.
|
|
IFN- -mediated enhancement of IgG2 production takes place during the first few days of culture (Kawano et al., 1994), and removal of CD56+ cells from P. gingivalis-stimulated PBL cultures reduced the level of IFN- that had accumulated during this period by about half. For example, the addition of P. gingivalis to PBL cultures enriched with 105 dendritic cells stimulated 394 ± 44 picograms of IFN- /mL at day 5, and removal of CD56+ cells from these cultures reduced the IFN- level to 189 ± 65 picograms of IFN- /mL (p < 0.01), suggesting that NK cells are as important as Th cells in the IFN- response during this early period. In harmony with our postulate, removal of CD56+ cells from PBL cultures resulted in a substantial reduction in P. gingivalis-specific IgG2 (Fig. 3B ), suggesting that these innate cells help to regulate this adaptive immune response.
 |
DISCUSSION
|
|---|
Dendritic cells are capable of engaging and internalizing a wide variety of pathogens, and, upon endocytosis, they can process antigens, prime naïve T-cells, and initiate adaptive immune responses (Inaba et al., 1990). In addition, dendritic cells stimulate NK cells, and this process is facilitated by the production of cytokines, including IL-12. IL-12 is a 70-kDa heterodimer consisting of IL-12p40 and p35, encoded by different genes, and both subunits must be expressed in the same dendritic cell to generate the heterodimer. The ability of dendritic cells to engage P. gingivalis and produce IL-12 is weak compared with that of A. actinomycetemcomitans or E. coli (Kikuchi et al., 2004). P. gingivalis LPS does not stimulate through TLR4 effectively, and it can even inhibit TLR4 stimulation by E. coli LPS (Bainbridge and Darveau, 2001; Yoshimura et al., 2002). P. gingivalis fimbriae are known to promote dendritic cell-trapping and induction of IL-12 (Jotwani and Cutler, 2004). The W83 strain used possesses fimbriae, and dendritic cell-IL-12p70 production was obtained, although the response was modest in the absence of IFN- . A recent study of P. gingivalis LPS on dendritic cell activation suggested that the weak immunostimulatory activity of P. gingivalis LPS might contribute to chronic periodontal inflammation (Kanaya et al., 2004). Studies of a model where F. nucleatum was used prior to P. gingivalis to replicate the sequential Gram-negative infections associated with periodontal disease indicated that T-cell responses tended to be Th2 rather than Th1 (Choi et al., 2001). Using real-time quantitative PCR, we found that stimulation of dendritic cells with P. gingivalis for 3 hrs did not increase the expression of IL-12p35. However, when dendritic cells were given IFN- , which may be obtained from NK cells, expression of IL-12p35 increased substantially in P. gingivalis-stimulated dendritic cells, and potent IL-12p70 responses were apparent. Optimal induction of p35 mRNA in monocytes requires IFN- priming in addition to pathogen contact (Hayes et al., 1995), and the same appears to apply to dendritic cells. In short, analysis of the present data indicates that P. gingivalis-stimulated dendritic cells interact with NK cells that produce high levels of IFN- , and that IFN- promotes IL-12 production by dendritic cells. Given that NK cells need IL-12 for optimal IFN- , it appears that P. gingivalis-dendritic cell-NK interactions can result in reciprocal activation and increased cytokine production by both dendritic cells and NK cells.
We are impressed by the magnitude of the IFN- -dependent IgG2 response to P. gingivalis serotype-specific antigens in aggressive as well as chronic periodontitis patients (Califano et al., 1999). Given that P. gingivalis does not appear to be a potent Th1 inducer, it prompted questions about the source of IFN- needed to induce P. gingivalis-specific IgG2. In the present study, we found that P. gingivalis-stimulated dendritic cells induced the production of large amounts of IFN- by NK cells. Furthermore, this IFN- response occurred in the first few days of culture, when IFN- is known to play a role in promoting IgG2 production (Kawano et al., 1994). Moreover, removal of NK cells from PBL cultures reduced IFN- levels in the cultures and inhibited the recall IgG2 antibody response to P. gingivalis. Analysis of these data suggests that NK cells may provide IFN- needed to induce the P. gingivalis-specific IgG2 observed at high levels in patients gingival crevicular fluid and serum. The potential role for NK cells in the induction of this IgG2 response represents yet another example of how the innate immune system can regulate expression of the adaptive immune system.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Kimberly Lake and Gail Smith for management of subjects and Margaret Poland for assistance in managing the fiscal issues. We thank Jeffery G. Tew for technical assistance in the laboratory. This investigation was supported by USPHS Research Grants DE13102 and AI-17142 from the National Institutes of Health, Bethesda, MD 20892, USA.
Received for publication November 1, 2004.
Revision received May 2, 2005.
Accepted for publication May 13, 2005.
 |
REFERENCES
|
|---|
- Agostini C, Facco M, Chilosi M, Semenzato G (2001). Alveolar macrophage-T cell interactions during Th1-type sarcoid inflammation. Microsc Res Tech 53:278–287.[CrossRef][Medline]
[Order article via Infotrieve]
- Bainbridge BW, Darveau RP (2001). Porphyromonas gingivalis lipopolysaccharide: an unusual pattern recognition receptor ligand for the innate host defense system. Acta Odontol Scand 59:131–138.[CrossRef][Medline]
[Order article via Infotrieve]
- Barbour SE, Ishihara Y, Fakher M, Al-Darmaki S, Caven TH, Shelburne CP, et al. (2002). Monocyte differentiation in localized juvenile periodontitis is skewed toward the dendritic cell phenotype. Infect Immun 70:2780–2786.[Abstract/Free Full Text]
- Brandtzaeg P (2001). Inflammatory bowel disease: clinics and pathology. Do inflammatory bowel disease and periodontal disease have similar immunopathogeneses? Acta Odontol Scand 59:235–243.[CrossRef][Medline]
[Order article via Infotrieve]
- Califano JV, Gunsolley JC, Schenkein HA, Tew JG (1997). A comparison of IgG antibody reactive with Bacteroides forsythus and Porphyromonas gingivalis in adult and early-onset periodontitis. J Periodontol 68:734–738.[Medline]
[Order article via Infotrieve]
- Califano JV, Schifferle RE, Gunsolley JC, Best AM, Schenkein HA, Tew JG (1999). Antibody reactive with Porphyromonas gingivalis serotypes K1-6 in adult and generalized early-onset periodontitis. J Periodontol 70:730–735.[CrossRef][Medline]
[Order article via Infotrieve]
- Choi J, Borrello MA, Smith E, Cutler CW, Sojar H, Zauderer M (2001). Prior exposure of mice to Fusobacterium nucleatum modulates host response to Porphyromonas gingivalis. Oral Microbiol Immunol 16:338–344.[Medline]
[Order article via Infotrieve]
- Cirrincione C, Pimpinelli N, Orlando L, Romagnoli P (2002). Lamina propria dendritic cells express activation markers and contact lymphocytes in chronic periodontitis. J Periodontol 73:45–52.[CrossRef][Medline]
[Order article via Infotrieve]
- Cooper MA, Fehniger TA, Fuchs A, Colonna M, Caligiuri MA (2004). NK cell and DC interactions. Trends Immunol 25:47–52.[CrossRef][Medline]
[Order article via Infotrieve]
- Ferlazzo G, Munz C (2004). NK cell compartments and their activation by dendritic cells. J Immunol 172:1333–1339.[Free Full Text]
- Gunsolley JC, Burmeister JA, Tew JG, Best AM, Ranney RR (1987). Relationship of serum antibody to attachment level patterns in young adults with juvenile periodontitis or generalized severe periodontitis. J Periodontol 58:314–320.[Medline]
[Order article via Infotrieve]
- Haffajee AD, Socransky SS (1994). Microbial etiological agents of destructive periodontal diseases. Periodontol 2000 6:78–111.
- Hayes MP, Wang J, Norcross MA (1995). Regulation of interleukin-12 expression in human monocytes: selective priming by interferon-gamma of lipopolysaccharide-inducible p35 and p40 genes. Blood 86:646–650.[Abstract/Free Full Text]
- Inaba K, Metlay JP, Crowley MT, Steinman RM (1990). Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ. J Exp Med 172:631–640; erratum 172:1275.[Abstract/Free Full Text]
- Jotwani R, Cutler CW (2003). Multiple dendritic cell (DC) subpopulations in human gingiva and association of mature DCs with CD4+ T-cells in situ. J Dent Res 82:736–741.
- Jotwani R, Cutler CW (2004). Fimbriated Porphyromonas gingivalis is more efficient than fimbria-deficient P. gingivalis in entering human dendritic cells in vitro and induces an inflammatory Th1 effector response. Infect Immun 72:1725–1732.[Abstract/Free Full Text]
- Jotwani R, Palucka AK, Al-Quotub M, Nouri-Shirazi M, Kim J, Bell D, et al. (2001). Mature dendritic cells infiltrate the T cell-rich region of oral mucosa in chronic periodontitis: in situ, in vivo, and in vitro studies. J Immunol 167:4693–4700.[Abstract/Free Full Text]
- Jotwani R, Pulendran B, Agrawal S, Cutler CW (2003). Human dendritic cells respond to Porphyromonas gingivalis LPS by promoting a Th2 effector response in vitro. Eur J Immunol 33:2980–2986.[CrossRef][Medline]
[Order article via Infotrieve]
- Kanaya S, Nemoto E, Ogawa T, Shimauchi H (2004). Porphyromonas gingivalis lipopolysaccharides induce maturation of dendritic cells with CD14+CD16+ phenotype. Eur J Immunol 34:1451–1460.[Medline]
[Order article via Infotrieve]
- Kawano Y, Noma T, Yata J (1994). Regulation of human IgG subclass production by cytokines. IFN-gamma and IL-6 act antagonistically in the induction of human IgG1 but additively in the induction of IgG2. J Immunol 153:4948–4958.[Abstract]
- Kikuchi T, Hahn CL, Tanaka S, Barbour SE, Schenkein HA, Tew JG (2004). Dendritic cells stimulated with Actinobacillus actinomycetemcomitans elicit rapid gamma interferon responses by natural killer cells. Infect Immun 72:5089–5096.[Abstract/Free Full Text]
- Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402–408.[CrossRef][Medline]
[Order article via Infotrieve]
- Salvi GE, Brown CE, Fujihashi K, Kiyono H, Smith FW, Beck JD, et al. (1998). Inflammatory mediators of the terminal dentition in adult and early onset periodontitis. J Periodontal Res 33:212–225.[CrossRef][Medline]
[Order article via Infotrieve]
- Takeichi O, Haber J, Kawai T, Smith DJ, Moro I, Taubman MA (2000). Cytokine profiles of T-lymphocytes from gingival tissues with pathological pocketing. J Dent Res 79:1548–1555.
- Tew JG, Marshall DR, Burmeister JA, Ranney RR (1985). Relationship between gingival crevicular fluid and serum antibody titers in young adults with generalized and localized periodontitis. Infect Immun 49:487–493.[Abstract/Free Full Text]
- Tew JG, Wu J, Fakher M, Szakal AK, Qin D (2001). Follicular dendritic cells: beyond the necessity of T-cell help. Trends Immunol 22:361–367.[CrossRef][Medline]
[Order article via Infotrieve]
- Wu J, Qin D, Burton GF, Szakal AK, Tew JG (1996). Follicular dendritic cell-derived antigen and accessory activity in initiation of memory IgG responses in vitro. J Immunol 157:3404–3411.[Abstract]
- Yoshimura A, Kaneko T, Kato Y, Golenbock DT, Hara Y (2002). Lipopolysaccharides from periodontopathic bacteria Porphyromonas gingivalis and Capnocytophaga ochracea are antagonists for human toll-like receptor 4. Infect Immun 70:218–225.[Abstract/Free Full Text]
Journal of Dental Research, Vol. 84, No. 9,
858-862 (2005)
DOI: 10.1177/154405910508400915

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Sasaki, N. Suzuki, R. Kent Jr., N. Kawashima, J. Takeda, and P. Stashenko
T Cell Response Mediated by Myeloid Cell-Derived IL-12 Is Responsible for Porphyromonas gingivalis-Induced Periodontitis in IL-10-Deficient Mice
J. Immunol.,
May 1, 2008;
180(9):
6193 - 6198.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|