Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

CiteULike is a free service for managing and discovering scholarly references - click here to get started.

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Lucchini, M.
Right arrow Articles by Farges, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lucchini, M.
Right arrow Articles by Farges, J.-C.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

{alpha}vβ3 Integrin Expression in Human Odontoblasts and Co-localization with Osteoadherin

M. Lucchini, M.-L. Couble, A. Romeas, M.-J. Staquet, F. Bleicher, H. Magloire and J.-C. Farges*

Laboratory of Development of Dental Tissues, EA 1892, IFR 62, Faculty of Odontology, Lyon 1 University, G. Paradin Str., 69372 Lyon Cedex 08, France;

Correspondence: * corresponding author, farges{at}laennec.univ-lyon1.fr


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Integrins are heterodimeric transmembrane receptors which promote cell adhesion, thus contributing to the maintenance of tissue organization in both normal and pathological conditions. To characterize the way odontoblasts may interact with other cells and the extracellular matrix in human teeth, we studied expression of {alpha}vβ3 integrin, a putative receptor for osteoadherin. We showed that {alpha}vβ3 integrin expression was restricted to odontoblasts, blood vessels, and small rounded cells in sound and carious pulp. Odontoblast staining intensity increased from the apical to the cusp region. Osteoadherin staining was strong in the whole odontoblast layer (with a slight decrease in the cusp region) and in predentin. Odontoblasts differentiating in vitro were stained with the anti-{alpha}vβ3 integrin antibody, first at the level of intercellular contacts, then throughout the cell membrane. These results suggest that the {alpha}vβ3 integrin could play a role in interodontoblast adhesion and odontoblast binding to the surrounding predentin/dentin/pulp matrix, possibly through osteoadherin.

Key Words: tooth pulp • dentin extracellular matrix • cell adhesion • intercellular contacts • blood vessel


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Integrins are transmembrane receptors which promote both cell-cell and cell-extracellular matrix adhesion. Those heterodimers of non-covalently-bound {alpha} and β subunits show a wide tissue distribution and play key roles in developmental, physiological, and pathological processes. The ligand specificity relies on the combination of both {alpha}/β subunits (18 different {alpha} integrins, 8 different β integrins). Ligand binding to the receptor extracellular domain induces a conformational change that is propagated to the cytoplasmic domain and initiates downstream signaling events related to cytoskeletal re-arrangements. As a consequence, integrins are involved in many fundamental cellular functions, including proliferation, adhesion, motility, differentiation, survival, and apoptosis (Hynes, 2002). In vivo studies conducted with {alpha}v- and β3-null mice supported the implication of the {alpha}vβ3 integrin in placenta development, secondary palate formation, blood vessel resistance to leakage, and bone resorption (Bader et al., 1998; Hodivala-Dilke et al., 1999; McHugh et al., 2000). In vitro studies showed that the {alpha}vβ3 integrin could also be involved in wound repair in connective tissues (Gailit et al., 1997).

The {alpha}vβ3 integrin was first characterized as the vitronectin receptor, but it exhibits a wide spectrum of extracellular ligands, including fibronectin, fibrinogen, von Willebrand factor, thrombospondin, osteopontin, tenascin, bone sialoprotein, plasminogen activator inhibitor-1, prothrombin, neurite cell adhesion molecule L1, metalloproteinase 2, ADAM-15 and -23 disintegrins (Plow et al., 2000), and TGF-β1 and -β3 latency-associated proteins (Ludbrook et al., 2003). The {alpha}vβ3 integrin was also proposed to be a membrane receptor for osteoadherin, a small leucine-rich proteoglycan synthesized by bovine osteoblasts (Wendel et al., 1998). We previously showed that osteoadherin was expressed by mouse osteoblasts, odontoblasts, and ameloblasts (Buchaille et al., 2000) and by human odontoblasts (Lucchini et al., 2002). Osteoadherin was recently localized extracellularly in alveolar bone, predentin, and enamel matrices of rat and mouse teeth (Couble et al., 2004). Since odontoblasts and osteoblasts share common protein expression profiles, we hypothesized that the {alpha}vβ3 integrin could mediate odontoblast adhesion to osteoadherin. The aims of this study were to characterize {alpha}vβ3 integrin expression in the human dental pulp by RT-PCR and in situ hybridization, and then to compare {alpha}vβ3 integrin and osteoadherin protein distribution in vivo and in odontoblasts differentiating in vitro.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue and Section Preparation
Fifteen sound non-erupted and 6 carious erupted human third molars were collected from 14- to 18-year-old patients with informed consent from their parents, in accordance with French legal requirements as stated in article 672-1, Public Health Code, and according to a protocol reviewed and approved by the local ethics committee. Pulps were fixed in 4% paraformaldehyde-phosphate-buffered saline (PBS) solution and routinely treated for freezing or paraffin embedding (Melin et al., 2000). From 8- to 10-µm serial sections were then made, collected on 3-aminopropyltriethoxysilane-coated slices, and air-dried.

RT-PCR
Total RNA was extracted from pulp samples as described by Buchaille et al.(2000) with use of the RNeasy Mini Kit and protocol (Qiagen, Chatsworth, CA, USA). A 200-ng quantity of total RNA was reverse-transcribed and amplified by polymerase chain-reaction with the Titan One Tube RT-PCR System (Roche Diagnostics, Mannheim, Germany). Primers were for the {alpha}v integrin subunit (forward, ACTGGGAGCACAAGGAGAACC; reverse, CCG CTTAGTGATGAGATGGTC) and for the β3 integrin subunit (forward, CCTACATGACCGAAAATACCT; reverse, AATCCCTCCCCACAAATACTG). Thirty cycles of PCR amplification were performed with an annealing temperature of 53°C. PCR products (expected fragment sizes: {alpha}v integrin subunit, 305 bp; β3 integrin subunit, 517 bp) were analyzed by 2% agarose gel electrophoresis with the NuSieve 3:1 (FMC Bioproducts, Rockland, ME, USA), the bands being visualized with ethidium bromide.

In situ Hybridization
Probe labeling and in situ hybridization were performed as previously described (Bleicher et al., 1999). {alpha}v and β3 integrin PCR products were electro-eluted from a 2% agarose gel, and 25 ng of these DNA templates were subjected to asymmetric PCR in 10 mM Tris-HCl (pH 8.3), 50 mM KCL, 1.5 mM MgCl2, 0.2 mM (dATP, dGTP, dTTP), 1.7 µM dCTP, 50 mM ({alpha}33P)-dCTP (2500 Ci/mmol), 2 units of TaqDNA polymerase, and 20 pmol antisense primer (10 cycles; annealing temperature, 50°C). The reaction was stopped by 0.2 mM ethylene diamine tetraacetic acid. The sense primer was used to synthesize the control (sense) probe under the same conditions. Pulp frozen sections were pre-hybridized for 2 hrs at 37°C by incubation in 50% de-ionized formamide, 10 mM NaPO4 (pH 7.4), 2 x SSC, 5 mM EDTA, 2.5 x Denhardt’s solution, 250 µg/mL denatured herring sperm DNA, and 500 µg/mL yeast tRNAs. Slides were rapidly rinsed in 2 x SSC, dehydrated in ethanol, and air-dried. Hybridization was performed overnight at 37°C, with the radioactive probe diluted in 50 µL of the pre-hybridization solution without tRNAs but with 0.04 g/mL dextran sulfate (final concentration of the probe: 40-80.106 cpm/mL). Slides were then washed in 2 x SSC for 30 min, 1 x SSC for 1 hr, and 0.5 x SSC for 1 hr. After the slides were dehydrated and air-dried, they were dipped in LM-1 emulsion for autoradiography (Amersham Biosciences, Freiburg, Germany). Emulsions were developed in Kodak D-19 developer and fixed in 30% sodium thiosulfate. Slides were slightly counterstained with Masson’s Hemalun.

Cell Culture
Thirty human odontoblast cell cultures were performed [as described by Couble et al.(2000)] from 5 sound non-erupted third molars. The pulp tissue was separated from the dentin/enamel mineralized complex, and its apical end was removed to prevent periodontal cell contamination. Pulp explants (about 2 mm3) were placed in Permanox Lab-Tek chamber slides (Nunc, Naperville, IL, USA), then cultures were performed in Eagle’s basal medium (Invitrogen, Grand Island, NY, USA) supplemented with 15% fetal calf serum (Eurobio, Les Ulis, France), 50 µg/mL acid ascorbic, 10 mM β-glycerophosphate (Sigma, St. Louis, MO, USA), and 100 IU/mL penicillin-50 mg/mL streptomycin (Invitrogen). Cells were grown at 37°C in a humidified atmosphere of 5% CO2 in air for 4 wks, then prepared for immunohistochemistry.

Immunohistochemistry
Immunoperoxidase histochemistry was performed by routine procedures as previously described (Farges et al., 2003; Couble et al., 2004). Sections and cultures were incubated with anti-{alpha}vβ3 integrin monoclonal antibody (1:100) (clone LM609, Chemicon International, Temecula, CA, USA) or anti-osteoadherin polyclonal antibody (1:500). Osteoadherin antiserum was prepared as described (Couble et al., 2004). It was raised by immunization of a rabbit against 3 synthetic peptides highly conserved among rat, mouse, and human osteoadherin (ETIQLKTQVFRPYQD, residues 371–385; YNSHYYEMQEWQDTI, residues 412–425; CQYEAYRWDDDYDQE, residues 20–34), respectively. Peptide synthesis and the immunization procedure were performed by CovalAb-Lyon (France). Peptides were conjugated to keyhole limpet hemocyanin (KLH), mixed with an equal volume of Freund’s complete adjuvant, and injected into multiple subcutaneous sites in the rabbit. Animals were boosted 3 wks later with the peptide-conjugate in Freund’s incomplete adjuvant until a sufficient antibody titer was obtained, and assessed by ELISA titration. For antiserum purification, peptides were coupled to sepharose gel and antibodies affinity-purified by standard methods.

Antibody detection was performed with the use of a Vectastain Elite ABC kit (Vector Labs, Burlingame, CA, USA) according to the protocol of the manufacturer, peroxidase being localized with diaminobenzidine.

Western Blotting
Proteins were classically extracted from odontoblast cell cultures by means of Laemmli’s buffer and osteoadherin identified by Western blotting. Anti-osteoadherin polyclonal antibody was diluted in PBS-2% BSA at a concentration of 1:4000, and staining was detected with horseradish-peroxidase-conjugated goat anti-rabbit IgG (DAKO, Glostrup, Denmark) (dilution 1:2000). Immunoreactivity was visualized by means of a chemiluminescence ECL system (Amersham Pharmacia Biotech, Buckinghamshire, England). Control was accomplished by omission of the primary antibody.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Analysis of the whole pulp by RT-PCR revealed the presence of mRNAs for both {alpha}v and β3 integrin subunits (Fig. 1aGo). Transcripts were detected by in situ hybridization in mature odontoblasts (Figs. 1bGo, 1cGo) and in cells surrounding blood vessels (Figs. 1dGo, 1eGo), but not in pulp core cells. No signal was present on sections hybridized with the sense probe (Fig. 1fGo).


Figure 1
View larger version (101K):
[in this window]
[in a new window]

 
Figure 1. Expression of {alpha}v and β3 integrin subunit genes in human dental pulp. (a) Analysis of the whole pulp by RT-PCR revealed the presence of mRNAs for both integrin subunits. PCR products migrate to a position in good agreement with their predicted sizes ({alpha}v, 305 bp; β3, 517 bp). Ethidium-bromide-stained 2% agarose gel. Digestion with restriction enzymes confirmed amplicon identity (not shown). M: molecular-weight markers (pUC Mix Marker 8, Fermentas Inc., Hanover, MD, USA). (b-e) Detection of {alpha}v and β3 integrin transcripts by in situ hybridization. {alpha}v and β3 integrin subunit mRNAs were present in mature odontoblasts (Od) (b,c) and in cells surrounding blood vessels (BV) (d,e), but not in pulp core cells (P). (f) Hybridization with the β3 integrin subunit sense probe. No signal was detected. Bars: 40 µm.

 
In vivo immunolocalization of the {alpha}vβ3 integrin showed an intense staining of the cell membrane in mature odontoblasts of the pulp horn, including processes in dentin tubules (Fig. 2aGo). Some blood vessels were also heavily stained, whereas others were not (Fig. 2bGo). Isolated cells in the blood vessel wall were also positive (Fig. 2bGo). On the same tooth section, {alpha}vβ3 integrin staining decreased progressively in the apical direction and became moderate in cervical odontoblasts (Fig. 2cGo). In newly differentiated odontoblasts of the forming root, the staining was weak and less intense than in blood vessels (Fig. 2dGo). In teeth with mild caries (Fig. 2eGo), odontoblasts producing reactionary dentin (situated in the black box on Fig.2eGo) were stained with the anti-{alpha}vβ3 integrin antibody (Fig. 2fGo). Blood vessels and small rounded cells present in the pulp parenchyma were also stained (Fig. 2gGo). Osteoadherin was immunodetected in pulp horn odontoblasts, including processes entering dentin tubules (Fig. 2hGo). Newly differentiated odontoblasts and predentin in the forming root were heavily stained (Fig. 2iGo). No obvious difference in osteoadherin staining intensity was observed between odontoblasts under healthy and those under carious dentin (data not shown).


Figure 2
View larger version (62K):
[in this window]
[in a new window]

 
Figure 2. Immunolocalization of {alpha}vβ3 integrin and osteoadherin in human dental pulp. (a) An intense membrane staining was observed with the anti-{alpha}vβ3 integrin antibody in mature odontoblasts (Od) of the pulp horn, including processes in dentin tubules (arrows). (b) Some blood vessels (BV) were also heavily stained, whereas others were not. Isolated cells in the blood vessel wall were also positive (arrow). (c) In the same tooth section, {alpha}vβ3 integrin staining decreased progressively in the apical direction and became moderate in cervical odontoblasts. (d) In newly differentiated odontoblasts of the forming root, the staining was weak and less intense than in blood vessels. (e) A third molar with a mild caries lesion (C) was used for {alpha}vβ3 staining. The black box indicates the localization of Figs. 2fGo and 2gGo. (f) Odontoblasts aligned at the pulp periphery or included in the reactionary dentin matrix (RD) were stained with the anti-{alpha}vβ3 integrin antibody. (g) Blood vessels and small rounded cells scattered in the tissue (arrow) were also stained. (h) Osteoadherin was immunodetected in pulp horn odontoblasts, including processes in dentin tubules (arrows). No other cell type was stained. (i) Newly differentiated odontoblasts in the forming root were heavily stained. Osteoadherin was also detected in predentin (Pd). D: dentin. P: pulp. Bars: 50 µm.

 
In vitro, confluent cells in the middle of the culture generally showed strong staining of the membrane with the anti-{alpha}vβ3 integrin antibody and moderate staining of the cytoplasm (Fig. 3aGo). Cell body and process were clearly delineated in some cells with typical odontoblast morphology (Fig. 3bGo). At the culture periphery, where newly polarized cells aligned to constitute a typical odontoblast layer, {alpha}vβ3 staining was detected on the membrane of odontoblast cell bodies at the level of contact zones and intercellular junctions (Fig. 3cGo). Osteoadherin was identified by immunoblot analysis in extracts of odontoblast cell cultures. Under reducing conditions, a single band of 110 kDa was stained with the anti-osteoadherin antibody (Fig. 3dGo). No immunoreactive band was observed when the anti-osteoadherin antiserum was omitted. By immunohistochemistry, osteoadherin staining was detected intracellularly close to the odontoblast nucleus in vitro, but not in the extracellular compartment (Fig. 3eGo).


Figure 3
View larger version (77K):
[in this window]
[in a new window]

 
Figure 3. Immunolocalization of {alpha}vβ3 integrin and osteoadherin in odontoblasts differentiated in vitro. (a) Confluent cells in the middle of the culture showed strong membrane staining with the anti-{alpha}vβ3 integrin antibody and moderate staining of the cytoplasm. (b) Cell body and process were clearly delineated in some cells with typical odontoblast morphology. (c) At the culture periphery, where newly polarized cells aligned to constitute a typical odontoblast layer, {alpha}vβ3 staining was detected on the membrane of odontoblast cell bodies at the level of contact zones and intercellular junctions (arrows). (d) In extracts of odontoblast cell cultures, osteoadherin was biochemically identified as a 110-kDa molecule with the purified anti-peptide antiserum (reducing conditions). No immunoreactive band was observed when the anti-osteoadherin antibody was omitted. (e) Osteoadherin staining was detected intracellularly close to the nucleus in all odontoblasts in vitro, but not in the extracellular compartment. Bars: 100 µm (a), 50 µm (b,c), 75 µm (e).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we report for the first time the presence of an integrin receptor, that is, {alpha}vβ3 integrin, in the cell membrane of human odontoblasts in vivo by in situ hybridization and immunohistochemistry. {alpha}vβ3 integrin staining was also observed in blood vessel cells, thus constituting a good positive control. Indeed, endothelial and vascular smooth-muscle cells were previously shown to express {alpha}vβ3 integrin (Eliceiri and Cheresh, 2001; Moiseeva, 2001). {alpha}vβ3 integrin gene expression was previously detected in vitro in human dental pulp stem cells (Shi et al., 2001). In vivo, {alpha}v, β1, β3, and β5 integrin subunits were detected in mesenchymal papilla cells during early murine tooth germ development, but their presence in differentiated odontoblasts was not reported (Ruch et al., 1995; Salmivirta et al., 1996). In our study, both the odontoblast cell body and process were immunostained. With regard to these localizations, different roles for the {alpha}vβ3 integrin might be suggested. At the basal pole, this receptor could mediate odontoblast adhesion to the sub-odontoblastic pulpal extracellular matrix. {alpha}vβ3 integrin detection on the lateral surfaces of odontoblasts at the level of cell-cell contact suggests that this receptor could be a crucial element for the formation of interodontoblast adhesion sites and odontoblast layer organization. Further, as odontoblasts move centripetally throughout the life of the tooth toward the pulp core, following dentin matrix deposition, the presence of the {alpha}vβ3 integrin on odontoblast lateral sides could help to maintain the structure and to prevent the disruption of the odontoblast layer. Integrin activation would thus contribute by interaction with the cytoskeleton to the continuous re-organization of actin microfilaments that accompanies odontoblast process elongation and the cell body moving toward the pulp core. Apically, the {alpha}vβ3 integrin might be involved in the determination of the position and in the stabilization of the odontoblast process by anchoring to predentin and intratubular matrix, thus sustaining the odontoblast phenotype. The absence of process staining in odontoblasts newly differentiated in vitro seems to preclude a direct role for {alpha}vβ3 integrin in odontoblast process formation and/or initial elongation. In the context of a dental pulp subjected to a carious aggression, a possible role for {alpha}vβ3 integrin would be the maintenance of the organization and of the cohesion of the odontoblast layer to prevent micro-organisms and/or exogenous molecules from diffusing through dentinal tubules to reach the sub-odontoblast peripheral pulp. Further, by maintaining a constant link with the extracellular matrix and with neighboring cells, the {alpha}vβ3 integrin could provide a critical survival signal and prevent the odontoblast anoikis—apoptotic death due to disruption of interactions between cells—that is classically observed under caries lesions (Magloire et al., 1992).

The {alpha}vβ3 integrin was also detected in isolated small rounded cells present in the blood vessel wall, as well as in the pulp paremchyma under caries lesions. The localization and the typical morphology of these cells suggest that they could be immune cells migrating from the blood circulation to the pulpal connective tissue. Indeed, the {alpha}vβ3 integrin was shown to be involved in the migration of monocytes and lymphocytes through the vascular endothelium (Weerasinghe et al., 1998).

Osteoadherin was proposed to be a potential ligand for {alpha}vβ3 integrin in bovine osteoblasts (Wendel et al., 1998). The {alpha}vβ3 integrin could mediate human odontoblast adhesion to osteoadherin, because odontoblasts co-produced both proteins. However, staining patterns for {alpha}vβ3 integrin and osteoadherin were not totally superimposable: Osteoadherin staining was strong at the onset of predentin synthesis in newly differentiated odontoblasts, whereas {alpha}vβ3 integrin staining was weak in these cells and progressively increased during odontoblast maturation. It is thus possible that the {alpha}vβ3 integrin could bind to other odontoblast-derived molecules present in the human odontoblast layer and/or predentin, such as tenascin and fibronectin (Lukinmaa et al., 1991), bone sialoprotein (Bègue-Kirn et al., 1994), and osteopontin (Bronckers et al., 1989), which are all known to bind the {alpha}vβ3 integrin. Other odontoblast-derived RGD-containing proteins, such as dentin sialoprotein and dentin matrix protein-1, are also candidates for binding to odontoblast integrins. Thus, considering the great number of potential ligands, it cannot be excluded that the {alpha}vβ3 integrin ligand may change in relation to the odontoblast differentiation status and the local matrix environment. Finally, the absence of difference in osteoadherin staining intensity under healthy and carious dentin might indicate that osteoadherin expression is not highly affected in odontoblasts re-activated by carious aggression.

In conclusion, our results suggest that the {alpha}vβ3 integrin could play a role in interodontoblast adhesion and odontoblast binding to the surrounding predentin/dentin/pulp matrix, possibly through osteoadherin. This receptor may thus be of great interest for the development of therapeutic strategies, including biomolecules capable of maintaining odontoblast shape/function and spatial organization in pathological conditions.


    ACKNOWLEDGMENTS
 
The authors gratefully acknowledge Dr. R.O. Hynes, Howard Hughes Medical Institute, Department of Biology, Massachusetts Institute of Technology, Cambridge, USA, for critical reading of the manuscript. They also express their gratitude to the staff of the Stomatology Department, Saint Joseph Hospital, and to Dr. P. Exbrayat, Faculty of Odontology, Lyon, for collecting tooth samples. This work was supported by grants from the French Ministery of National Education, Research and Technology.

Received for publication October 16, 2003. Revision received April 20, 2004. Accepted for publication May 6, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Bader BL, Rayburn H, Crowley D, Hynes RO (1998). Extensive vasculogenesis, angiogenesis, and organogenesis precede lethality in mice lacking all {alpha}v integrins. Cell 95:507–519.[CrossRef][Medline] [Order article via Infotrieve]
  • Bègue-Kirn C, Smith AJ, Loriot M, Kupferle C, Ruch J-V, Lesot H (1994). Comparative analysis of TGFβs, BMPs, IGF1, msxs, fibronectin, osteonectin and bone sialoprotein expression during normal and in vitro-induced odontoblast differentiation. Int J Dev Biol 38:405–420.[Medline] [Order article via Infotrieve]
  • Bleicher F, Couble M-L, Farges J-C, Couble P, Magloire H (1999). Sequential expression of matrix protein genes in developing rat teeth. Matrix Biol 18:133–143.[CrossRef][Medline] [Order article via Infotrieve]
  • Bronckers ALJJ, Lyaruu DM, Woltgens JHM (1989). Immunohistochemistry of extracellular matrix proteins during various stages of dentinogenesis. Connect Tissue Res 22:65–70.[Medline] [Order article via Infotrieve]
  • Buchaille R, Couble M-L, Magloire H, Bleicher F (2000). Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone 27:265–270.
  • Couble M-L, Farges J-C, Bleicher F, Perrat-Mabillon B, Boudeulle M, Magloire H (2000). Odontoblast differentiation of human dental pulp cells in vitro. Calcif Tissue Int 66:129–138.[CrossRef][Medline] [Order article via Infotrieve]
  • Couble M-L, Bleicher F, Farges J-C, Peyrol S, Lucchini M, Magloire H, et al. (2004). Immunodetection of osteoadherin in murine tooth extracellular matrices. Histochem Cell Biol 121:47–53.[Medline] [Order article via Infotrieve]
  • Eliceiri BP, Cheresh DA (2001). Adhesion events in angiogenesis. Curr Opin Cell Biol 13:563–568.[CrossRef][Medline] [Order article via Infotrieve]
  • Farges J-C, Romeas A, Melin M, Pin J-J, Lebecque S, Lucchini M, et al. (2003). TGF-β1 induces accumulation of dendritic cells in the odontoblast layer. J Dent Res 82:654–658.
  • Gailit J, Clarke C, Newman D, Tonnesen MG, Mosesson MW, Clark RAF (1997). Human fibroblasts bind directly to fibrinogen at RGD sites through integrin {alpha}vβ3. Exp Cell Res 232:118–126.[CrossRef][Medline] [Order article via Infotrieve]
  • Hodivala-Dilke KM, McHugh KP, Tsakiris DA, Rayburn H, Crowley D, Ullman-Culleré M, et al. (1999). β3-integrin-deficient mice are a model for Glanzmann thrombasthenia showing placental defects and reduced survival. J Clin Invest 103:229–238.[Medline] [Order article via Infotrieve]
  • Hynes RO (2002). Integrins: bidirectional allosteric signaling machines. Cell 110:673–687.[CrossRef][Medline] [Order article via Infotrieve]
  • Lucchini M, Romeas A, Couble M-L, Bleicher F, Magloire H, Farges J-C (2002). TGF-β1 signaling and stimulation of osteoadherin in human odontoblasts in vitro. Connect Tissue Res 43:345–353.[CrossRef][Medline] [Order article via Infotrieve]
  • Ludbrook SB, Barry ST, Delves CJ, Horgan CMT (2003). The integrin {alpha}vβ3 is a receptor for the latency-associated peptides of transforming growth factors β1 and β3. Biochem J 369:311–318.[CrossRef][Medline] [Order article via Infotrieve]
  • Lukinmaa P-L, Mackie EJ, Thesleff I (1991). Immunohistochemical localization of the matrix glycoproteins—tenascin and the ED-sequence-containing form of cellular fibronectin—in human permanent teeth and periodontal ligament. J Dent Res 70:19–26.
  • Magloire H, Bouvier M, Joffre A (1992). Odontoblast response under carious lesions. Proc Finn Dent Soc 88(Suppl I):257–274.
  • McHugh KP, Hodivala-Dilke K, Zheng MH, Namba N, Lam J, Novack D, et al. (2000). Mice lacking β3 integrins are osteosclerotic because of dysfunctional osteoclasts. J Clin Invest 105:433–440.[Medline] [Order article via Infotrieve]
  • Melin M, Joffre-Romeas A, Farges J-C, Couble M-L, Magloire H, Bleicher F (2000). Effects of TGFβ1 on dental pulp cells in cultured human tooth slices. J Dent Res 79:1689–1696.
  • Moiseeva EP (2001). Adhesion receptors of vascular smooth muscle cells and their functions. Cardiovascular Res 52:372–386.[Abstract/Free Full Text]
  • Plow EF, Haas TA, Zhang L, Loftus J, Smith JW (2000). Ligand binding to integrins. J Biol Chem 275:21785–21788.[Free Full Text]
  • Ruch JV, Lesot H, Bègue-Kirn C (1995). Odontoblast differentiation. Int J Dev Biol 39:51–68.[Medline] [Order article via Infotrieve]
  • Salmivirta K, Gullberg D, Hirsch E, Altruda F, Ekblom P (1996). Integrin subunit expression associated with epithelial-mesenchymal interactions during murine tooth development. Dev Dyn 205:104–113.[CrossRef][Medline] [Order article via Infotrieve]
  • Shi S, Robey PG, Gronthos S (2001). Comparison of human dental pulp and bone marrow stromal stem cells by cDNA microarray analysis. Bone 29:532–539.[CrossRef][Medline] [Order article via Infotrieve]
  • Weerasinghe D, McHugh KP, Ross FP, Brown EJ, Gisler RH, Imhof BA (1998). A role for the {alpha}vβ3 integrin in the transmigration of monocytes. J Cell Biol 142:595–607.[Abstract/Free Full Text]
  • Wendel M, Sommarin Y, Heinegärd D (1998). Bone matrix proteins: isolation and characterization of a novel cell-binding keratan sulfate proteoglycan (osteoadherin) from bovine bone. J Cell Biol 114:839–847.

Journal of Dental Research, Vol. 83, No. 7, 552-556 (2004)
DOI: 10.1177/154405910408300708


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
S. H. Durand, V. Flacher, A. Romeas, F. Carrouel, E. Colomb, C. Vincent, H. Magloire, M.-L. Couble, F. Bleicher, M.-J. Staquet, et al.
Lipoteichoic Acid Increases TLR and Functional Chemokine Expression while Reducing Dentin Formation in In Vitro Differentiated Human Odontoblasts.
J. Immunol., March 1, 2006; 176(5): 2880 - 2887.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Lucchini, M.
Right arrow Articles by Farges, J.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lucchini, M.
Right arrow Articles by Farges, J.-C.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?