| Sign In to gain access to subscriptions and/or personal tools. |
Amelogenin p.M1T and p.W4S Mutations Underlying Hypoplastic X-linked Amelogenesis Imperfecta
1 Department of Orthodontics and Pediatric Dentistry, University of Michigan Dental Research Lab, 1210 Eisenhower Place, Ann Arbor, MI 48108; Correspondence: * corresponding author, janhu{at}umich.edu
Mutations in the human amelogenin gene (AMELX, Xp22.3) cause a phenotypically diverse set of inherited enamel malformations. We hypothesize that the effects of specific mutations on amelogenin protein structure and expression will correlate with the enamel phenotype, clarify amelogenin structure/function relationships, and improve the clinical diagnosis of X-linked amelogenesis imperfecta (AI). We have identified two kindreds with X-linked AI and characterized the AMELX mutations underlying their AI phenotypes. The two missense mutations are both in exon 2 and affect the translation initiation codon and/or the secretion of amelogenin (p.M1T and p.W4S), resulting in hypoplastic enamel. Primary anterior teeth from affected females with the p.M1T mutation were characterized by light and scanning electron microscopy. The thin enamel had defective prism organization, and the surface was rough and pitted. Dentin was normal. The severity of the enamel phenotype correlated with the predicted effects of the mutations on amelogenin expression and secretion.
Key Words: enamel amelogenin amelogenesis imperfecta hypoplastic AI AMELX
In humans, amelogenin genes are located on the X and Y chromosomes (Lau et al., 1989; Nakahori et al., 1991). In males (XY), 90% of the amelogenin transcripts are expressed from AMELX, and only 10% are expressed from AMELY (Salido et al., 1992). Mutational analyses have identified 12 different AMELX mutations in kindreds afflicted with X-linked AI (Hart et al., 2002). The AMELX mutations include missense and nonsense mutations and deletions of various sizes, which result in markedly different enamel phenotypes. A recent study of phenotype/genotype correlations in kindreds expressing defined AMELX mutations noted a clustering of AI phenotypes according to their effects on the translated amelogenin protein (Wright et al., 2003). Two mutations have been identified in the coding region for the amelogenin signal peptide (MGTWILFACLLGAAFA). The first mutation involved the deletion of 9 nucleotides that replaced amino acids 5 through 8 (ILFA) with threonine (T) (Lagerström-Fermer et al., 1995). This I5-A8delinsT mutation caused the synthesis of a normal amelogenin protein fused to a defective signal peptide. Clinically, the incisal edges of the anterior teeth showed prominent mammelons, and the enamel was thinner than normal but appeared to be properly mineralized. The female carriers were less severely affected, with islands of alternating normal and defective enamel. The second signal peptide defect was a point mutation (W4X) that also caused severe enamel hypoplasia (Sekiguchi et al., 2001). The thin enamel had a slightly coarse surface, and the incisal edges of the anterior teeth were rough due to exaggerated mammelons and incisal chipping. The presence or absence of a vertical banding pattern in the dentition of the affected female was not reported. The translational stop signal replacing the fourth codon (W4X) might have resulted in a null mutation, but because an upstream short reading frame often allows ribosomes to re-initiate at appropriate downstream start codons (Kozak, 1984), such a mutation might also have caused translation to initiate from the Met17 codon, resulting in the intracellular expression of the normally secreted amelogenin protein. Here we report two AMELX mutations (p.M1T and p.W4S) within the coding region for the amelogenin signal peptide, which brings to four the number of mutations predicted to interfere with the secretion of amelogenin. The common phenotype in these four kindreds is enamel hypoplasia with malformed incisal edges on the anterior teeth. The enamel appears to have mineralized normally and contrasts with dentin on radiographs. In the case of the four signal peptide mutations in AMELX, there is a strong correlation between phenotype and genotype, which could help clinicians in making a diagnosis of X-linked AI.
Identification of Kindreds and Enrollment of Human Subjects Two eight-year-old female patients from unrelated families were identified as having AI. Pedigrees were constructed based upon oral histories. In both families, affected individuals were identified in all generations, and the number of affected females greatly exceeded the number of affected males. These observations suggested that the mode of inheritance was likely to be X-linked, and that the underlying mutation would be in the amelogenin gene. Members of both kindreds were recruited for AMELX mutational analysis. The study protocol and patient consents were reviewed and approved by the Institution Review Boards at the University of Texas Health Science Center at San Antonio and at the University of Michigan.
Polymerase Chain-reaction (PCR) and DNA Sequencing
Oligonucleotide primers for polymerase chain-reaction were designed with the use of Primer3 on the Web (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) (Rozen and Skaletsky, 2000). The strategy was to generate amplification products that would allow for DNA sequencing, in both directions, of each amelogenin exon and ~ 50 bp of their adjoining introns. The oligonucleotide sequences, their annealing sites, and the sizes of their amplification products are shown in Fig. 1
Single-stranded Conformational Polymorphism (SSCP) Analysis After an AMELX mutation was found in family 1, we designed PCR primers for SSCP analysis (forward primer, TGGAGCATTCATTACATCCAT; reverse primer, TGCAAGGGGTGTTTTACTCA; product size, 152 bp). The PCR products were mixed with formamide loading buffer (95% formamide with bromophenol blue and xylenecyanol), heated to 95°C for 5 min, quenched on ice, and loaded onto 20% polyacrylamide gel. Electrophoresis was performed with the constant ampere mode of 250 V, 15 mA, for 4 hrs and 30 min. The gel was stained by means of the Silver Stain Plus Kit (BioRad, Hercules, CA, USA).
Light and Scanning Electron Microscopy
Two kindreds afflicted with X-linked AI were recruited for mutation analysis. In both families, the proband was a young girl in the mixed-dentition stage of development. Using newly designed PCR primer pairs and genomic DNA template from affected members, we generated exon-specific AMELX amplification products ranging from 575 to 775 bp in length (Fig. 1
Family 1 is a kindred in which the AI affection status, based upon the family history, is known for 5 generations (Fig. 2
The teeth of the proband in family 1 had sharp, thin incisal edges that fractured easily in both the maxillary and mandibular anterior teeth. The anterior incisors had diastemas, and the enamel layer was extremely thin and slightly rough. The underlying dentin appeared to show through the thin enamel covering, and gave the teeth a yellowish shade. On dental radiographs, the enamel layer was more radiopaque than dentin but was difficult to delineate because of its thinness. No vertical banding pattern was evident in the enamel of affected females. The only affected male recruited from this kindred had crowns covering all of his teeth, but his panorex from age 27, taken before the full-mouth reconstruction, showed no evidence of enamel on any of the teeth (based upon radiodensity and the contour of the crowns), although a very thin layer of enamel approximating the radiopacity of dentin could have been present without showing up on the radiograph.
Naturally exfoliated primary cuspids and a mandibular central incisor were obtained from girls having the p.M1T mutation (Fig. 3
Family 2 was a small kindred in which the AI affection status was known to span three generations, with a single affected female in each generation (Fig. 2 The incisal edges of the anterior teeth on the proband showed developmentally prominent mammelons, which were apparently preserved by the anterior open bite. The affected mother reported having previously undergone orthodontic treatment for correction of an anterior open bite. The enamel, although thinner than normal, was not as thin as in family 1 and could be readily identified on radiographs as a continuous radiopaque layer covering the dentin. The underlying dentin appeared to show through the thin enamel covering, but the resulting yellowish shade was also not as strong as in family 1. Both affected females showed a pattern of alternative vertical bands of thin enamel and enamel of more normal thickness.
In this study, we have identified two AMELX mutations in exon 2 that cause X-linked AI. The first mutation disrupts the translation initiation codon (p.M1T); the second mutation changes the fourth amino acid in the signal peptide (p.W4S). One possible effect of the p.M1T mutation would be to block translation of amelogenin expressed from the defective mRNA transcripts (null mutation). On the other hand, translation might not be blocked, but rather shifted to the second ATG (encoding Met17), which is also encoded in exon 2 and is normally at the N-terminus of the secreted amelogenin protein. This second start codon is theoretically acceptable for translation initiation as adenosine is in the –3 position (Kozak, 1984), but would be a weak translation initiator relative to the normal start codon (Kozak, 1986). The effect of p.M1T, therefore, might be the expression of the secreted amelogenin protein intracellularly, but at lower levels than are normally secreted by wild-type cells. The p.W4S mutation in family 2 is in the signal peptide-coding region and might be expected to reduce translocation of the nascent amelogenin protein into the endoplasmic reticulum. Signal peptide prediction software (SignalP V2.0, at http://www.cbs.dtu.dk/services/SignalP/) predicted that the mutant (p.W4S) signal peptide sequence would not be greatly affected by the serine for tryptophan substitution (Nielsen et al., 1997). However, a mutation in the DSPP signal peptide-coding region was shown to reduce translocation of that protein greatly, despite a similar prediction by this software (Rajpar et al., 2002). The tryptophan mutated in family 2 is strictly conserved in every mammal for which sequence is known. This, and the finding that this mutation is associated with enamel hypoplasia in our kindred, suggests that the p.W4S mutation might reduce secretion of amelogenin protein, and cause some amelogenin protein fused to the defective signal peptide to be synthesized in the cytoplasm. This amelogenin protein might be expressed at higher levels than in family 1, but might be degraded more rapidly if protein folding is affected by the retained signal peptide. The intracellular expression of amelogenin might interfere with normal cell processes, making the dental phenotype a sum of the effects of cell pathology and a reduction of amelogenin protein in the matrix. Pathologically thin, or hypoplastic, enamel is caused by a failure in crystal elongation, which occurs during the secretory stage of amelogenesis (Simmer and Fincham, 1995; Fincham et al., 1999). After the enamel crystals achieve their final length (and the enamel layer itself achieves its final thickness), the organic matrix separating individual enamel crystallites is degraded and re-absorbed. If the organic matrix is not properly removed, pathologically soft (hypomaturation) forms of AI result (Smith, 1998). In the four AI cases where a signal peptide mutation blocks amelogenin secretion, the defect appears to have affected the secretory stage only. In cases where a defective amelogenin protein is secreted, the mutant amelogenin protein may be resistant to degradation by enamel proteases and may not be thoroughly cleared from the matrix, resulting in a hypomaturation type of AI, which may produce a more noticeable Lyonization pattern (Collier et al., 1997; Li et al., 2003). Clinically, females with X-linked AI often show vertical bands of apparently normal, translucent enamel alternating with thinner (hypoplastic) white opaque enamel. These vertical bands are believed to be an "X-inactivation pattern" or "Lyonization" pattern, due to the presence of alternating bands of ameloblasts secreting normal and defective amelogenin (Berkman and Singer, 1971; Witkop and Sauk, 1976). Phenotype variation in females heterozygous for X-linked genes can be caused by non-random X-chromosome inactivation (Sharp et al., 2000; Plenge et al., 2002). At the present time, there is no evidence that skewing of X-inactivation causes variations in the AI phenotype that might explain the apparent lack of a Lyonization pattern in family 1 with X-linked AI. The most common mechanism that skews X-inactivation is when a disproportionate number of cells show inactivation of the mutated over the wild-type X chromosome through cell selection, that is, cells expressing the mutant gene die or cannot divide as well as those expressing the wild-type gene (Lyon, 2002). In such cases, however, proliferative selection against cells expressing the abnormal gene to cells expressing the wild-type copy is expected to cause a more mild phenotype in the female than might occur in the absence of such selection. In our family 1, where the phenotype in females is severe, selection against cells expressing the mutant amelogenin gene (p.M1T) seems unlikely. In family 2, the comparatively mild phenotype is readily explained if the signal peptide mutation (p.W4S) only partially interfered with translocation into the endoplasmic reticulum (ER). Any amelogenin that did make it into the ER would be secreted as a perfectly normal amelogenin protein. There are currently no data concerning the relative expression of amelogenin from the paternal and maternal X chromosomes in either normal or diseased individuals. Despite this, skewed X-inactivation patterns must be considered as a possible cause of phenotypic variation in X-linked AI. In the four kindreds showing amelogenin signal peptide mutations, the phenotype is remarkably consistent. Severe enamel hypoplasia with a slightly rough surface, exaggerated mammelons, or incisal chipping with an X-linked pattern of inheritance should arouse suspicion of a possible mutation in exon 2 of the AMELX. The presence or absence of an anterior open bite is not a consistent finding in the kindreds with an AMELX signal peptide mutation, and suggests that it is a secondary rather than a direct pleiotropic effect of the gene mutation.
This investigation was supported in part by the Foundation of the American Academy of Pediatric Dentistry, and by USPHS Research Grants DE12769, DE11301, and DE12879 from the National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 29892. Received for publication July 3, 2003. Revision received March 4, 2004. Accepted for publication March 5, 2004.
Journal of Dental Research, Vol. 83, No. 5,
378-383 (2004) This article has been cited by other articles:
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






