Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

CiteULike is a free service for managing and discovering scholarly references - click here to get started.

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Kim, J.-W.
Right arrow Articles by Hu, J.C.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J.-W.
Right arrow Articles by Hu, J.C.-C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Clinical

Amelogenin p.M1T and p.W4S Mutations Underlying Hypoplastic X-linked Amelogenesis Imperfecta

J.-W. Kim1,2, J.P. Simmer1, Y.Y. Hu1, B.P.-L. Lin3, C. Boyd4, J.T. Wright4, C.J.M. Yamada1, S.K. Rayes1, R.J. Feigal5 and J.C.-C. Hu1,*

1 Department of Orthodontics and Pediatric Dentistry, University of Michigan Dental Research Lab, 1210 Eisenhower Place, Ann Arbor, MI 48108;
2 Seoul National University, College of Dentistry, Department of Pediatric Dentistry & Dental Research Institute, 28-2 Yongon-dong, Chongno-gu, Seoul, Korea 110-768;
3 University of Texas Health Science Center at San Antonio, Department of Pediatric Dentistry, 7703 Floyd Curl Drive, San Antonio, TX 78289-3900;
4 The University of North Carolina at Chapel Hill, School of Dentistry, Dental Research Center, Chapel Hill, NC 27599-7455; and
5 Department of Preventive Sciences, Moos Health Sciences Tower, 515 Delaware Street SE, Minneapolis, MN 55455;

Correspondence: * corresponding author, janhu{at}umich.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutations in the human amelogenin gene (AMELX, Xp22.3) cause a phenotypically diverse set of inherited enamel malformations. We hypothesize that the effects of specific mutations on amelogenin protein structure and expression will correlate with the enamel phenotype, clarify amelogenin structure/function relationships, and improve the clinical diagnosis of X-linked amelogenesis imperfecta (AI). We have identified two kindreds with X-linked AI and characterized the AMELX mutations underlying their AI phenotypes. The two missense mutations are both in exon 2 and affect the translation initiation codon and/or the secretion of amelogenin (p.M1T and p.W4S), resulting in hypoplastic enamel. Primary anterior teeth from affected females with the p.M1T mutation were characterized by light and scanning electron microscopy. The thin enamel had defective prism organization, and the surface was rough and pitted. Dentin was normal. The severity of the enamel phenotype correlated with the predicted effects of the mutations on amelogenin expression and secretion.

Key Words: enamel • amelogenin • amelogenesis imperfecta • hypoplastic AI • AMELX


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In humans, amelogenin genes are located on the X and Y chromosomes (Lau et al., 1989; Nakahori et al., 1991). In males (XY), 90% of the amelogenin transcripts are expressed from AMELX, and only 10% are expressed from AMELY (Salido et al., 1992). Mutational analyses have identified 12 different AMELX mutations in kindreds afflicted with X-linked AI (Hart et al., 2002). The AMELX mutations include missense and nonsense mutations and deletions of various sizes, which result in markedly different enamel phenotypes. A recent study of phenotype/genotype correlations in kindreds expressing defined AMELX mutations noted a clustering of AI phenotypes according to their effects on the translated amelogenin protein (Wright et al., 2003).

Two mutations have been identified in the coding region for the amelogenin signal peptide (MGTWILFACLLGAAFA). The first mutation involved the deletion of 9 nucleotides that replaced amino acids 5 through 8 (ILFA) with threonine (T) (Lagerström-Fermer et al., 1995). This I5-A8delinsT mutation caused the synthesis of a normal amelogenin protein fused to a defective signal peptide. Clinically, the incisal edges of the anterior teeth showed prominent mammelons, and the enamel was thinner than normal but appeared to be properly mineralized. The female carriers were less severely affected, with islands of alternating normal and defective enamel. The second signal peptide defect was a point mutation (W4X) that also caused severe enamel hypoplasia (Sekiguchi et al., 2001). The thin enamel had a slightly coarse surface, and the incisal edges of the anterior teeth were rough due to exaggerated mammelons and incisal chipping. The presence or absence of a vertical banding pattern in the dentition of the affected female was not reported. The translational stop signal replacing the fourth codon (W4X) might have resulted in a null mutation, but because an upstream short reading frame often allows ribosomes to re-initiate at appropriate downstream start codons (Kozak, 1984), such a mutation might also have caused translation to initiate from the Met17 codon, resulting in the intracellular expression of the normally secreted amelogenin protein.

Here we report two AMELX mutations (p.M1T and p.W4S) within the coding region for the amelogenin signal peptide, which brings to four the number of mutations predicted to interfere with the secretion of amelogenin. The common phenotype in these four kindreds is enamel hypoplasia with malformed incisal edges on the anterior teeth. The enamel appears to have mineralized normally and contrasts with dentin on radiographs. In the case of the four signal peptide mutations in AMELX, there is a strong correlation between phenotype and genotype, which could help clinicians in making a diagnosis of X-linked AI.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of Kindreds and Enrollment of Human Subjects
Two eight-year-old female patients from unrelated families were identified as having AI. Pedigrees were constructed based upon oral histories. In both families, affected individuals were identified in all generations, and the number of affected females greatly exceeded the number of affected males. These observations suggested that the mode of inheritance was likely to be X-linked, and that the underlying mutation would be in the amelogenin gene. Members of both kindreds were recruited for AMELX mutational analysis. The study protocol and patient consents were reviewed and approved by the Institution Review Boards at the University of Texas Health Science Center at San Antonio and at the University of Michigan.

Polymerase Chain-reaction (PCR) and DNA Sequencing
A 10-cc quantity of peripheral whole blood was obtained from participating family members. Genomic DNA was isolated with the use of the QIAamp DNA Blood Maxi Kit (Qiagen Inc., Valencia, CA, USA). The purity and concentration of the DNA were quantitated by spectrophotometry, as measured by the OD260/OD280 ratio.

Oligonucleotide primers for polymerase chain-reaction were designed with the use of Primer3 on the Web (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) (Rozen and Skaletsky, 2000). The strategy was to generate amplification products that would allow for DNA sequencing, in both directions, of each amelogenin exon and ~ 50 bp of their adjoining introns. The oligonucleotide sequences, their annealing sites, and the sizes of their amplification products are shown in Fig. 1Go. The concentration of purified amplimer was estimated by the intensity of its ethidium-bromide-stained band on a 1% agarose gel, and 6–8 ng/µL (1 ng/µL for each 100 bp) of template and 3.2 pMol/µL of primer were used in each sequencing reaction.


Figure 1
View larger version (51K):
[in this window]
[in a new window]

 
Figure 1. Strategy for mutation analysis. The structure of the human amelogenin gene is shown at the top. The exons are blocks numbered 1 through 7. Below each exon is a bar corresponding to the region amplified and a number indicating the number of nucleotides in each PCR product. The DNA sequences of the primer pairs used to generate the exon-specific PCR amplification products, written in the 5' to 3' orientation, are shown below, along with the annealing temperature used in the amplifications, provided in the table at the bottom. The PCR reactions have a five-minute denaturation at 94°C, followed by 40–50 cycles each with denaturation at 94°C for 30 sec, primer annealing at 56–61°C (as shown in the table) for 30 sec, and product extension at 72°C for 40 sec. In the final cycle, the 72°C extension was for 5 min. PCR amplification products were purified by use of the QIAquick PCR Purification Kit (Qiagen Inc., Valencia, CA, USA), and are shown on a 1% agarose gel stained with ethidium bromide, in the center of the Fig.

 
Single-stranded Conformational Polymorphism (SSCP) Analysis
After an AMELX mutation was found in family 1, we designed PCR primers for SSCP analysis (forward primer, TGGAGCATTCATTACATCCAT; reverse primer, TGCAAGGGGTGTTTTACTCA; product size, 152 bp). The PCR products were mixed with formamide loading buffer (95% formamide with bromophenol blue and xylenecyanol), heated to 95°C for 5 min, quenched on ice, and loaded onto 20% polyacrylamide gel. Electrophoresis was performed with the constant ampere mode of 250 V, 15 mA, for 4 hrs and 30 min. The gel was stained by means of the Silver Stain Plus Kit (BioRad, Hercules, CA, USA).

Light and Scanning Electron Microscopy
Two naturally exfoliated primary cuspids and a primary mandibular central incisor were obtained from the proband and an affected sister with the p.M1T mutation for histological analysis of the enamel and dentin. Thin sections were cut with a diamond blade to thicknesses of approximately 120 µm and examined with light microscopy as previously described (Wright et al., 1993a). Samples for scanning electron microscopy were either fractured or cut, polished to a 0.25-µm finish, and etched for 60 sec with 0.07 M H3PO4 as previously described (Wright et al., 1993b).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Two kindreds afflicted with X-linked AI were recruited for mutation analysis. In both families, the proband was a young girl in the mixed-dentition stage of development. Using newly designed PCR primer pairs and genomic DNA template from affected members, we generated exon-specific AMELX amplification products ranging from 575 to 775 bp in length (Fig. 1Go), which were characterized by DNA sequencing. Different exon 2 mutations were identified in the two families, and these mutations correlated with affection status.

Family 1 is a kindred in which the AI affection status, based upon the family history, is known for 5 generations (Fig. 2Go). Eleven members of this kindred were recruited, which included six unaffected (four females, two males) and five affected (four females, one male) members. Genomic DNA was amplified and characterized from an affected male (IV-2). The seven AMELX amplification products varied from the AMELX reference sequence (AY040206) in exon 2, which altered the amelogenin translation initiation codon, and in exon 6, which did not alter the deduced amino acid sequence. Single-stranded conformational polymorphism (SSCP) analysis showed that the exon 2 mutation was present in all of the five affected, and in none of the six unaffected, family members (Fig. 2Go). Based upon the amelogenin genomic (AY040206), cDNA, and deduced amino acid (AF436849) reference sequences, and the published standardized nomenclature for AI mutations (Hart et al., 2002), the start codon mutation in family 1 is described as g.2T>C for the gene, c.2T>C for the cDNA, and p.M1T for the protein. The polymorphism in exon 6 is g.3834C>T for the gene and g.261C>T for the cDNA.


Figure 2
View larger version (69K):
[in this window]
[in a new window]

 
Figure 2. Genotype and phenotypes of AI families. Panels A through I are from family 1 (p.M1T): oral photograph of the proband (A); the pedigree (B); bitewing radiographs of the proband, showing the very thin enamel layer that is evident only radiographically on the cusp tips (C,D); DNA sequencing chromatograms (E–H) of exon 2 from an affected male member (IV-2) showing the mutation (Mut) that changed the ATG of the wild-type (Wt) start codon into an ACG, which is normally a threonine codon; and single-stranded conformational polymorphism (SSCP) analysis of exon 2, with arrowheads pointing to the extra band that correlates with affection status (I). Panels J through P are from family 2 (p.W4S): oral photographs of the proband (J, III-2) and her mother (K, II-2), who were both affected; the pedigree of family 2 (L); and DNA sequencing chromatograms from the proband, showing the mutation in the fourth codon of exon 2 (M-P), which changed the wild-type tryptophan codon (TGG) into a serine (TCG) codon.

 
The teeth of the proband in family 1 had sharp, thin incisal edges that fractured easily in both the maxillary and mandibular anterior teeth. The anterior incisors had diastemas, and the enamel layer was extremely thin and slightly rough. The underlying dentin appeared to show through the thin enamel covering, and gave the teeth a yellowish shade. On dental radiographs, the enamel layer was more radiopaque than dentin but was difficult to delineate because of its thinness. No vertical banding pattern was evident in the enamel of affected females. The only affected male recruited from this kindred had crowns covering all of his teeth, but his panorex from age 27, taken before the full-mouth reconstruction, showed no evidence of enamel on any of the teeth (based upon radiodensity and the contour of the crowns), although a very thin layer of enamel approximating the radiopacity of dentin could have been present without showing up on the radiograph.

Naturally exfoliated primary cuspids and a mandibular central incisor were obtained from girls having the p.M1T mutation (Fig. 3Go). Light microscopy of ground sections showed that the enamel layer is very thin, or about 1/4 the thickness of a wild-type control (Figs. 3AGoGo3D). Scanning electron microscopy indicated that the thin enamel lacked a prismatic structure for the most part (Figs. 3EGo, 3FGo), although there were some areas that looked like they had an organized crystallite orientation that approached a normal prismatic pattern (Figs. 3GGo, 3HGo). The tooth surface was rough and pitted (Fig. 3IGo). The dentin appeared normal, with distinct dentinal tubules coursing from the DEJ pulpally (Figs. 3JGo, 3KGo).


Figure 3
View larger version (129K):
[in this window]
[in a new window]

 
Figure 3. Analysis of naturally exfoliated primary teeth from affected girls in family 1 (p.M1T). Ground sections of normal (A,C) and defective (B,D) teeth illustrate the relative thinness (1/4 of normal) of the enamel layer in the affected teeth. The enamel prism structure of the normal teeth is evident in scanning electron micrographs (E, bar = 100 µm), but is not evident, even at twice the magnification (F, bar = 100 µm), in affected teeth. At higher magnification, prism organization that only partially approaches that observed in normal enamel (G, bar = 10 µm) could be recognized in occasional areas (H, bar = 10 µm). To the unaided eye, the enamel surface of the affected teeth looked rough (I), which was due to the presence of pits along the enamel surface that varied in size from about 10 to 30 µm (F). The dentin appeared to be normal at low (J) and high (K, bar = 10 µm) magnifications, with well-defined dentinal tubules. Arrowheads indicate the DEJ.

 
Family 2 was a small kindred in which the AI affection status was known to span three generations, with a single affected female in each generation (Fig. 2Go). Only two affected females (II-2 and III-2) could be recruited. Genomic DNA from the proband (III-2) was amplified and characterized. A single sequence variation from the AMELX reference sequence was identified, which is predicted to change the fourth amino acid in the signal peptide from tryptophan to serine. The amelogenin mutation in family 2 is described as g.11G>C for the gene, c.11G>C for the cDNA, and p.W4S for the protein. Exon 2 from the mother (II-2) of the proband showed the same mutation.

The incisal edges of the anterior teeth on the proband showed developmentally prominent mammelons, which were apparently preserved by the anterior open bite. The affected mother reported having previously undergone orthodontic treatment for correction of an anterior open bite. The enamel, although thinner than normal, was not as thin as in family 1 and could be readily identified on radiographs as a continuous radiopaque layer covering the dentin. The underlying dentin appeared to show through the thin enamel covering, but the resulting yellowish shade was also not as strong as in family 1. Both affected females showed a pattern of alternative vertical bands of thin enamel and enamel of more normal thickness.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we have identified two AMELX mutations in exon 2 that cause X-linked AI. The first mutation disrupts the translation initiation codon (p.M1T); the second mutation changes the fourth amino acid in the signal peptide (p.W4S). One possible effect of the p.M1T mutation would be to block translation of amelogenin expressed from the defective mRNA transcripts (null mutation). On the other hand, translation might not be blocked, but rather shifted to the second ATG (encoding Met17), which is also encoded in exon 2 and is normally at the N-terminus of the secreted amelogenin protein. This second start codon is theoretically acceptable for translation initiation as adenosine is in the –3 position (Kozak, 1984), but would be a weak translation initiator relative to the normal start codon (Kozak, 1986). The effect of p.M1T, therefore, might be the expression of the secreted amelogenin protein intracellularly, but at lower levels than are normally secreted by wild-type cells. The p.W4S mutation in family 2 is in the signal peptide-coding region and might be expected to reduce translocation of the nascent amelogenin protein into the endoplasmic reticulum. Signal peptide prediction software (SignalP V2.0, at http://www.cbs.dtu.dk/services/SignalP/) predicted that the mutant (p.W4S) signal peptide sequence would not be greatly affected by the serine for tryptophan substitution (Nielsen et al., 1997). However, a mutation in the DSPP signal peptide-coding region was shown to reduce translocation of that protein greatly, despite a similar prediction by this software (Rajpar et al., 2002). The tryptophan mutated in family 2 is strictly conserved in every mammal for which sequence is known. This, and the finding that this mutation is associated with enamel hypoplasia in our kindred, suggests that the p.W4S mutation might reduce secretion of amelogenin protein, and cause some amelogenin protein fused to the defective signal peptide to be synthesized in the cytoplasm. This amelogenin protein might be expressed at higher levels than in family 1, but might be degraded more rapidly if protein folding is affected by the retained signal peptide. The intracellular expression of amelogenin might interfere with normal cell processes, making the dental phenotype a sum of the effects of cell pathology and a reduction of amelogenin protein in the matrix.

Pathologically thin, or hypoplastic, enamel is caused by a failure in crystal elongation, which occurs during the secretory stage of amelogenesis (Simmer and Fincham, 1995; Fincham et al., 1999). After the enamel crystals achieve their final length (and the enamel layer itself achieves its final thickness), the organic matrix separating individual enamel crystallites is degraded and re-absorbed. If the organic matrix is not properly removed, pathologically soft (hypomaturation) forms of AI result (Smith, 1998). In the four AI cases where a signal peptide mutation blocks amelogenin secretion, the defect appears to have affected the secretory stage only. In cases where a defective amelogenin protein is secreted, the mutant amelogenin protein may be resistant to degradation by enamel proteases and may not be thoroughly cleared from the matrix, resulting in a hypomaturation type of AI, which may produce a more noticeable Lyonization pattern (Collier et al., 1997; Li et al., 2003).

Clinically, females with X-linked AI often show vertical bands of apparently normal, translucent enamel alternating with thinner (hypoplastic) white opaque enamel. These vertical bands are believed to be an "X-inactivation pattern" or "Lyonization" pattern, due to the presence of alternating bands of ameloblasts secreting normal and defective amelogenin (Berkman and Singer, 1971; Witkop and Sauk, 1976). Phenotype variation in females heterozygous for X-linked genes can be caused by non-random X-chromosome inactivation (Sharp et al., 2000; Plenge et al., 2002). At the present time, there is no evidence that skewing of X-inactivation causes variations in the AI phenotype that might explain the apparent lack of a Lyonization pattern in family 1 with X-linked AI. The most common mechanism that skews X-inactivation is when a disproportionate number of cells show inactivation of the mutated over the wild-type X chromosome through cell selection, that is, cells expressing the mutant gene die or cannot divide as well as those expressing the wild-type gene (Lyon, 2002). In such cases, however, proliferative selection against cells expressing the abnormal gene to cells expressing the wild-type copy is expected to cause a more mild phenotype in the female than might occur in the absence of such selection. In our family 1, where the phenotype in females is severe, selection against cells expressing the mutant amelogenin gene (p.M1T) seems unlikely. In family 2, the comparatively mild phenotype is readily explained if the signal peptide mutation (p.W4S) only partially interfered with translocation into the endoplasmic reticulum (ER). Any amelogenin that did make it into the ER would be secreted as a perfectly normal amelogenin protein.

There are currently no data concerning the relative expression of amelogenin from the paternal and maternal X chromosomes in either normal or diseased individuals. Despite this, skewed X-inactivation patterns must be considered as a possible cause of phenotypic variation in X-linked AI. In the four kindreds showing amelogenin signal peptide mutations, the phenotype is remarkably consistent. Severe enamel hypoplasia with a slightly rough surface, exaggerated mammelons, or incisal chipping with an X-linked pattern of inheritance should arouse suspicion of a possible mutation in exon 2 of the AMELX. The presence or absence of an anterior open bite is not a consistent finding in the kindreds with an AMELX signal peptide mutation, and suggests that it is a secondary rather than a direct pleiotropic effect of the gene mutation.


    ACKNOWLEDGMENTS
 
This investigation was supported in part by the Foundation of the American Academy of Pediatric Dentistry, and by USPHS Research Grants DE12769, DE11301, and DE12879 from the National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 29892.

Received for publication July 3, 2003. Revision received March 4, 2004. Accepted for publication March 5, 2004.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Berkman MD, Singer A (1971). Demonstration of the Lyon hypothesis in X-linked dominant hypoplastic amelogenesis imperfecta. Birth Defects Orig Artic Ser 7:204–209.[Medline] [Order article via Infotrieve]
  • Collier PM, Sauk JJ, Rosenbloom SJ, Yuan ZA, Gibson CW (1997). An amelogenin gene defect associated with human X-linked amelogenesis imperfecta. Arch Oral Biol 42:235–242.[CrossRef][Medline] [Order article via Infotrieve]
  • Fincham AG, Moradian-Oldak J, Simmer JP (1999). The structural biology of the developing dental enamel matrix. J Struct Biol 126:270–299.[CrossRef][Medline] [Order article via Infotrieve]
  • Hart PS, Hart TC, Simmer JP, Wright JT (2002). A nomenclature for X-linked amelogenesis imperfecta. Arch Oral Biol 47:255–260.[CrossRef][Medline] [Order article via Infotrieve]
  • Kozak M (1984). Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res 12:857–872.[Abstract/Free Full Text]
  • Kozak M (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44:283–292.[Medline] [Order article via Infotrieve]
  • Lagerström-Fermer M, Nilsson M, Bäckman B, Salido E, Shapiro L, Pettersson U, et al. (1995). Amelogenin signal peptide mutation: correlation between mutations in the amelogenin gene (AMGX) and manifestations of X-linked amelogenesis imperfecta. Genomics 26:159–162.[CrossRef][Medline] [Order article via Infotrieve]
  • Lau EC, Mohandas T, Shapiro LJ, Slavkin HC, Snead ML (1989). Human and mouse amelogenin gene loci are on the sex chromosomes. Genomics 4:162–168.[CrossRef][Medline] [Order article via Infotrieve]
  • Li W, Gao C, Yan Y, DenBesten P (2003). X-linked amelogenesis imperfecta may result from decreased formation of tyrosine rich amelogenin peptide (TRAP). Arch Oral Biol 48:177–183.[CrossRef][Medline] [Order article via Infotrieve]
  • Lyon MF (2002). X-chromosome inactivation and human genetic disease. Acta Paediatr Suppl 91:107–112.[CrossRef][Medline] [Order article via Infotrieve]
  • Nakahori Y, Takenaka O, Nakagome Y (1991). A human X-Y homologous region encodes amelogenin. Genomics 9:264–269.[CrossRef][Medline] [Order article via Infotrieve]
  • Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10:1–6.[Abstract/Free Full Text]
  • Plenge RM, Stevenson RA, Lubs HA, Schwartz CE, Willard HF (2002). Skewed X-chromosome inactivation is a common feature of X-linked mental retardation disorders. Am J Hum Genet 71:168–173.[CrossRef][Medline] [Order article via Infotrieve]
  • Rajpar MH, Koch MJ, Davies RM, Mellody KJ, Kielty CM, Dixon MJ (2002). Mutation of the signal peptide region of the bicistronic gene DSPP affects translocation to the endoplasmic reticulum and results in defective dentine biomineralization. Hum Mol Genet 11:2559–2565.[Abstract/Free Full Text]
  • Rozen S, Skaletsky H (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365–386.[Medline] [Order article via Infotrieve]
  • Salido EC, Yen PH, Koprivnikar K, Yu LC, Shapiro LJ (1992). The human enamel protein gene amelogenin is expressed from both the X and the Y chromosomes. Am J Hum Genet 50:303–316.[Medline] [Order article via Infotrieve]
  • Sekiguchi H, Kiyoshi M, Yakushiji M (2001). DNA diagnosis of X-linked amelogenesis imperfecta using PCR detection method of the human amelogenin gene. Dent Jpn 37:109–112.
  • Sharp A, Robinson D, Jacobs P (2000). Age- and tissue-specific variation of X chromosome inactivation ratios in normal women. Hum Genet 107:343–349.[CrossRef][Medline] [Order article via Infotrieve]
  • Simmer JP, Fincham AG (1995). Molecular mechanisms of dental enamel formation. Crit Rev Oral Biol Med 6:84–108.[Abstract/Free Full Text]
  • Smith CE (1998). Cellular and chemical events during enamel maturation. Crit Rev Oral Biol Med 9:128–161.[Abstract/Free Full Text]
  • Witkop CJ Jr, Sauk JJ Jr (1976). Heritable defects of enamel. In: Oral facial genetics. Stewart RE, Prescott GH, editors. St. Louis: C.V. Mosby Co., pp. 151–226.
  • Wright JT, Aldred MJ, Crawford PJ, Kirkham J, Robinson C (1993a). Enamel ultrastructure and protein content in X-linked amelogenesis imperfecta. Oral Surg Oral Med Oral Pathol 76:192–199.[CrossRef][Medline] [Order article via Infotrieve]
  • Wright JT, Duggal MS, Robinson C, Kirkham J, Shore R (1993b). The mineral composition and enamel ultrastructure of hypocalcified amelogenesis imperfecta. J Craniofacial Genet Dev Biol 13:117–126.[Medline] [Order article via Infotrieve]
  • Wright JT, Hart PS, Aldred MJ, Seow K, Crawford PJ, Hong SP, et al. (2003). Relationship of phenotype and genotype in X-linked amelogenesis imperfecta. Connect Tissue Res 44:72–78.[CrossRef][Medline] [Order article via Infotrieve]

Journal of Dental Research, Vol. 83, No. 5, 378-383 (2004)
DOI: 10.1177/154405910408300505


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
JDRHome page
H.-Y. Kang, F. Seymen, S.-K. Lee, M. Yildirim, E. B. Tuna, A. Patir, K.-E. Lee, and J.-W. Kim
Candidate Gene Strategy Reveals ENAM Mutations
Journal of Dental Research, March 1, 2009; 88(3): 266 - 269.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Masuya, K. Shimizu, H. Sezutsu, Y. Sakuraba, J. Nagano, A. Shimizu, N. Fujimoto, A. Kawai, I. Miura, H. Kaneda, et al.
Enamelin (Enam) is essential for amelogenesis: ENU-induced mouse mutants as models for different clinical subtypes of human amelogenesis imperfecta (AI)
Hum. Mol. Genet., March 1, 2005; 14(5): 575 - 583.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J-W Kim, J P Simmer, T C Hart, P S Hart, M D Ramaswami, J D Bartlett, and J C-C Hu
MMP-20 mutation in autosomal recessive pigmented hypomaturation amelogenesis imperfecta
J. Med. Genet., March 1, 2005; 42(3): 271 - 275.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Kim, J.-W.
Right arrow Articles by Hu, J.C.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kim, J.-W.
Right arrow Articles by Hu, J.C.-C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?