|
Sign In to gain access to subscriptions and/or personal tools.
|
RNA Profiling of Cell-free Saliva Using Microarray Technology
Y. Li1,
X. Zhou1,
M.A.R. St. John2 and
D.T.W. Wong1,3,4,*
1 School of Dentistry and Dental Research Institute, University of California-Los Angeles, 10833 Le Conte Ave., Rm. 73-017 CHS, Los Angeles, CA 90095;
2 School of Medicine, UCLA;
3 Jonsson Comprehensive Cancer Center, UCLA; and
4 Molecular Biology Institute, UCLA;
Correspondence: * corresponding author, dtww{at}ucla.edu
 |
ABSTRACT
|
|---|
Saliva, like other bodily fluids, has been used to monitor human health and disease. This study tests the hypothesis that informative human mRNA exists in cell-free saliva. If present, salivary mRNA may provide potential biomarkers to identify populations and patients at high risk for oral and systemic diseases. Unstimulated saliva was collected from ten normal subjects. RNA was isolated from the cell-free saliva supernatant and linearly amplified. High-density oligonucleotide microarrays were used to profile salivary mRNA. The results demonstrated that there are thousands of human mRNAs in cell-free saliva. Quantitative PCR (Q-PCR) analysis confirmed the present of mRNA identified by our microarray study. A reference database was generated based on the mRNA profiles in normal saliva. Our finding proposes a novel clinical approach to salivary diagnostics, Salivary Transcriptome Diagnostics (STD), for potential applications in disease diagnostics as well as normal health surveillance.
Key Words: saliva RNA microarray diagnostics
 |
INTRODUCTION
|
|---|
Saliva is not a passive "ultrafiltrate" of serum (Rehak et al., 2000), but contains a distinctive composition of enzymes, hormones, antibodies, and other molecules. In the past 10 years, the use of saliva as a diagnostic fluid has been successfully applied in diagnostics and for predicting populations at risk for a variety of conditions (Streckfus and Bigler, 2002). Diagnostic biomarkers in saliva have been identified for monitoring caries, periodontitis, oral cancer, salivary gland diseases, and systemic disorders, e.g., hepatitis and HIV (Lawrence, 2002).
Human genetic alterations are detectable both intracellularly and extracellularly (Sidransky, 1997). Nucleic acids have been identified in most bodily fluids, including blood, urine, and cerebrospinal fluid, and have been successfully adopted for use as diagnostic biomarkers for diseases (Anker et al., 1999; Rieger-Christ et al., 2003; Wong et al., 2003). Recent, investigators have become interested in detecting nucleic acid markers in saliva. To date, most of the DNA or RNA in saliva was found to be of viral or bacterial origin (Mercer et al., 2001; Stamey et al., 2003). There are limited reports demonstrating tumor cell DNA heterogeneity in the saliva of oral cancer patients (Liao et al., 2000; El-Naggar et al., 2001). We have not found published evidence of human mRNA detectable in saliva. The potential presence of mRNA in saliva may expand the repertoire of diagnostic analytes for translational and clinical applications.
Our laboratory has been actively involved in the application of patient-based genome-wide technologies to identify molecular biomarkers from saliva. We applied a series of emerging technologies to detect diagnostic analytes in saliva. A recent study from this laboratory (St. John et al., 2004) has identified salivary human interleukin 8 mRNA and protein to be diagnostic of patients with oral cavity and pharyngeal cancer. Based on this finding, we hypothesized that there are constituent human mRNAs in saliva. The purpose of this study was to determine the transcriptome profiles in cell-free saliva obtained from normal subjects. High-density oligonucleotide microarrays were used for the global transcriptome profiling. The salivary transcriptome patterns were used to generate a reference database for salivary transcriptome diagnostics applications.
 |
MATERIALS & METHODS
|
|---|
Normal Subjects
Saliva samples were obtained from ten normal donors from the Division of Otolaryngology, Head and Neck Surgery, at the Medical Center, University of California, Los Angeles (UCLA), CA, in accordance with a protocol approved by the UCLA Institutional Review Board. The following inclusion criteria were used: age 30 yrs, and no history of malignancy, immunodeficiency, autoimmune disorders, hepatitis, HIV infection, or smoking. The study population was composed of six males and four females, with an average age of 42 yrs (range from 32 to 55 yrs).
Saliva Collection and Processing
Unstimulated saliva samples were collected between 9 a.m. and 10 a.m. in accordance with published protocols (Navazesh, 1993). Subjects were asked to refrain from eating, drinking, smoking, or oral hygiene procedures for at least 1 hr prior to saliva collection. Saliva samples were centrifuged at 2600 x g for 15 min at 4°C. Saliva supernatant was separated from the cellular phase. RNase inhibitor (Superase-In, Ambion Inc., Austin, TX, USA) and protease inhibitor (Aprotinin, Sigma, St. Louis, MO, USA) were then added to the cell-free saliva supernatant.
RNA Isolation from Cell-free Saliva
RNA was isolated from the cell-free saliva supernatant according to the modified protocol from the manufacturer (QIAamp Viral RNA kit, Qiagen, Valencia, CA, USA). Saliva (560 µL), mixed well with AVL buffer (2240 µL), was incubated at room temperature for 10 min. Absolute ethanol (2240 µL) was added, and the solution passed through silica columns by centrifugation at 6000 x g for 1 min. The columns were then washed twice, centrifuged at 20,000 x g for 2 min, and eluted with 30 µL RNase-free water at 9000 x g for 2 min. Aliquots of RNA were treated with RNase-free DNase (DNase I-DNA-free, Ambion Inc., Austin, TX, USA) according to the manufacturers instructions. The quality of isolated RNA was examined by RT-PCR for three housekeeping gene transcripts: glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin-β (ACTB), and ribosomal protein S9 (RPS9). Primers were designed with the use of PRIMER3 software (http://www.genome.wi.mit.edu) and were synthesized commercially (Fisher Scientific, Tustin, CA, USA) as follows: 5' TCACCAGGGCTGCTTTTAACTC 3' and 5' ATGACAAGCTT CCCGTTCTCAG 3' for GAPDH; 5' AGGATGCAGAA GGAGATCACTG 3' and 5' ATACTCCTGC TTGCTGATCCAC 3' for ACTB; 5' GACCCTTCGAGAAA TCTCGTCTC 3' and 5' TCTCATCAAGCGTCAGCAGTTC 3' for RPS9. The quantity of RNA was estimated with the use of a Ribogreen® RNA Quantitation Kit (Molecular Probes, Eugene, OR, USA).
Target cRNA Preparation
Isolated RNA was subjected to linear amplification according to published methods from our laboratory (Ohyama et al., 2000). In brief, reverse transcription with T7-oligo-(dT)24 as the primer was performed to synthesize the first-strand cDNA. The first round of in vitro transcription (IVT) was carried out with T7 RNA polymerase (Ambion Inc., Austin, TX, USA). The BioArrayTM High Yield RNA Transcript Labeling System (Enzo Life Sciences, Farmingdale, NY, USA) was used for the second round IVT to biotinylate the cRNA product; the labeled cRNA was purified with the use of the GeneChip® Sample Cleanup Module (Affymetrix, Santa Clara, CA, USA). The quantity and quality of cRNA were determined by spectrophotometry and gel electrophoresis. Small aliquots from each of the isolation and amplification steps were used to assess the quality by RT-PCR. The quality of the fragmented cRNA (prepared as described by Kelly et al., 2002) was assessed by capillary electrophoresis with the 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).
HG-U133A Microarray Analysis
The Affymetrix Human Genome U133A Array, which contains 22,215 human gene cDNA probe sets representing ~ 19,000 genes (i.e., each gene may be represented by more than one probe set), was applied for gene expression profiling. The array data were normalized and analyzed by means of Microarray Suite (MAS) software (Affymetrix). A detection p-value was obtained for each probe set. Any probe set with p < 0.04 was assigned as "present", indicating that the matching gene transcript was reliably detected (Affymetrix, 2001). The total number of present probe sets on each array was obtained, and the percentage (P%) of present genes was calculated. Functional classification was performed on selected genes (present on all 10 arrays, p < 0.01) by means of the Gene Ontology Mining Tool (www.netaffx.com).
Quantitative Gene Expression Analysis by Q-PCR
Q-PCR was performed with use of an iCyclerTM thermal Cycler (Bio-Rad, Hercules, CA, USA). A 2-µL aliquot of the isolated salivary RNA (without amplification) was reverse-transcribed into cDNA by means of MuLV Reverse Transcriptase (Applied Biosystems, Foster City, CA, USA). The resulting cDNA (3 µL) was used for PCR amplification with iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). The primers were synthesized by Sigma-Genosys (Woodlands, TX, USA) as follows: 5' GTGCTGAATGTGGACTCAATCC 3' and 5' ACCCTAAGGCA GGCAGTTG 3' for interleukin 1-beta (IL1B); 5' CCTGCGAAGA GCGAAACCTG 3' and 5' TCAATACTGGACAGCACCCTCC 3' for stratifin (SFN); 5' AGCGTGCCTTTGTTCACTG 3' and 5' CACACCAACCTCCTCATAATCC 3' for tubulin-alpha, ubiquitous (K-ALPHA-1). All reactions were performed in triplicate, with conditions customized for the specific PCR products. The initial amount of cDNA of a particular template was extrapolated from a standard curve with the use of LightCycler software 3.0 (Bio-Rad, Hercules, CA, USA). The detailed procedure for quantification by standard curve has been previously described (Ginzinger, 2002).
 |
RESULTS
|
|---|
RNA Isolation and Amplification
On average, 60.5 ± 13.1 ng (n = 10) of total RNA was obtained from 560 µL cell-free saliva samples (Table 1 ). RT-PCR results demonstrated that all 10 saliva samples contained mRNAs that encode for housekeeping genes: GAPDH, ACTB, and RPS9. The mRNA of these genes could be preserved without significant degradation for more than 6 mos at –80°C (Fig. 1 ). After 2 rounds of T7 RNA linear amplification, the average yield of biotinylated cRNA was 42.2 ± 3.9 µg with A260/280 = 2.067 ± 0.082 (Table 1 ). The cRNA ranged from 200 bp to 4 kb before fragmentation and was concentrated to approximately 100 bp after fragmentation. The quality of cRNA probe was confirmed by capillary electrophoresis before the hybridizations. ACTB mRNA was detectable by PCR/RT-PCR on the original sample and products from each amplification step: first cDNA, first in vitro transcription (IVT), second cDNA, and second IVT (Fig. 2 ).

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1. Detection of gene-specific RNA in cell-free saliva by RT-PCR. (A) RNA stability in saliva was tested by RT-PCR typing for ACTB after storage for 1, 3, and 6 mos (lanes 2, 3, 4, respectively). Lane 1, molecular-weight marker (100-bp ladder); Lane 5, negative control (templates omitted). (B) GAPDH (B1), RPS9 (B2), and ACTB (B3) were detected consistently in all 10 cases. Lanes 1, 2, and 3 are saliva RNA, positive control (human total RNA; BD Biosciences Clontech, Palo Alto, CA, USA), and negative controls (templates omitted), respectively.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
Figure 2. Amplification of RNA from cell-free saliva for microarray study. (A) Monitoring of RNA amplification by agarose gel electrophoresis. Lanes 1 to 5 are 1-kb DNA ladder, 5 µL saliva after RNA isolation (undetectable), 1 µL of 2 round amplified cRNAs (range from 200 bp to ~ 4 kb), 1 µL cRNA after fragmentation (around 100 bp), and Ambion RNA Century Marker, respectively. (B) ACTB can be detected in every main step during salivary RNA amplification. The agarose gel shows an expected single band (153 bp) of PCR product. Lanes 1 to 8 are 100-bp DNA ladder, total RNA isolated from cell-free saliva, 1st round cDNA, 1st round cRNA after RT, 2nd round cDNA, 2nd round cRNA after RT, positive control (human total RNA, BD Biosciences Clontech, Palo Alto, CA, USA), and negative control (templates omitted), respectively. (C) Target cRNA analyzed by Agilent 2100 bioanalyzer before hybridization on microarray. Only one single peak in a narrow range (50–200 bp) was detected demonstrating proper fragmentation.
|
|
Microarray Profiling of Salivary mRNA
Salivary mRNA profiles of ten normal subjects were obtained by HG U133A array containing 22,283 cDNA probes. An average of 3143 ± 665.0 probe sets (p < 0.04) on each array (n = 10) were assigned as present. These probe sets represent approximately 3000 different mRNAs. The average present percentage was 14.11 ± 2.98% (n = 10). A reference database which includes data from the ten arrays was generated. The probe sets representing GAPDH, ACTB, and RPS9 were assigned as present on all 10 arrays. There were, in total, 207 probe sets, representing 185 genes assigned as present on all 10 arrays with detection p < 0.01. These genes were categorized on the basis of their known roles in biological processes and molecular functions (Table 2 ). The major functions of the 185 genes are related to cell growth/maintenance (119 genes), molecular binding (118 genes), and cellular structure composition (95 genes). We termed these "Normal Salivary Core Transcriptome (NSCT)".
View this table:
[in this window]
[in a new window]
|
Table 2. Biological Processes and Molecular Functions of 185 Genes in Cell-free Saliva from Ten Normal Donors (data obtained by means of the Gene Ontology Mining Tool)
|
|
Q-PCR Validation and Quantitation Analysis
We used real-time quantitative PCR (Q-PCR) to validate the presence of human mRNA in saliva by quantifying selected genes from the 185 "Normal Salivary Core Transcriptome" genes. We randomly selected IL1B, SFN, and K-ALPHA-1, which were assigned as present on all 10 arrays, for validation. Q-PCR results showed that mRNAs of IL1B, SFN, and K-ALPHA-1 were detectable in all 10 original, unamplified, cell-free saliva samples. The relative amounts (in copy number) of these transcripts (n = 10) are: 8.68 x 103 ± 4.15 x 103 for IL1B; 1.29 x 105 ± 1.08 x 105 for SFN; and 4.71 x 106 ± 8.37 x 105 for K-ALPHA-1. The relative RNA expression levels of these genes measured by Q-PCR were similar to those measured by the microarrays (data not shown).
 |
DISCUSSION
|
|---|
Saliva meets the demands of an inexpensive, non-invasive, and accessible bodily fluid to act as an ideal diagnostic medium. Specific and informative biomarkers in saliva are greatly needed to serve for diagnosing disease and monitoring human health (Bonassi et al., 2001; Streckfus and Bigler, 2002; Sidransky, 2002). Knowing the constituents in saliva is essential for using this medium to identify potential biomarkers for disease diagnostics (Pusch et al., 2003). One criticism has been the idea that informative molecules are generally present in low amounts in saliva. However, with new amplification techniques and highly sensitive assays, this may no longer be a limitation (Xiang et al., 2003). In our study, the human RNA was successfully isolated from unstimulated cell-free saliva supernatant. The quality of salivary mRNA was proved to be sufficient for use in RT-PCR, Q-PCR, and microarray experiments.
Distinct differences exist between saliva and other bodily fluids (e.g., blood), in that saliva naturally contains micro-organisms (Sakki and Knuuttila, 1996). In addition, some extraneous substances (e.g., food debris) make the composition of saliva more complex. Therefore, it is simpler and more accurate to use the fluid/supernatant phase of saliva, instead of whole saliva, as a medium for detecting biomarkers. In our study, the conditions for separating the pellet and saliva supernatant were optimized to avoid mechanical rupture of cellular elements which would contribute to the RNA detected in the fluidic cell-free phase (St. John et al., 2004). Our results demonstrate that it is feasible and efficient to use cell-free saliva for transcriptome analysis. While it is a novel finding that human mRNAs exist in cell-free saliva supernatant, nucleic acids have long been detected in other cell-free bodily fluids and subsequently used for disease diagnostics. For example, specific oncogene, tumor suppressor gene, and microsatellite alterations have been identified in patients serum (Anker et al., 2003). Moreover, tumor mRNAs have been isolated and amplified from serum of patients with different malignancies (Kopreski et al., 1999; Fleischhacker et al., 2001). It has been widely accepted that these genomic messengers, detected extracellularly, can serve as biomarkers for diseases (Sidransky, 1997).
To our knowledge, this is the first report where human mRNA in unstimulated saliva is globally profiled. Using microarray technology, we discovered that approximately 3000 different human mRNAs exist in cell-free saliva of each normal subject. The salivary transcriptome pattern in cell-free saliva from normal populations could potentially serve as a health-monitoring database. It should be noted that we now know the human genome composed of more than 30,000 genes (Venter et al., 2001), and the probe sets on the HG U133A microarray used in our study represent only ~ 19,000 human genes. Additional gene transcripts not detectable by the HG U133A microarray will likely exist in cell-free saliva. Therefore, it is reasonable to predict that more human mRNAs will be identified in saliva by other advanced methodologies. The identified gene transcripts in this study, particularly the Normal Salivary Core Transcriptome (NSCT) mRNAs, represent the common transcriptome of normal cell-free saliva. We hypothesize that a different, informative, and diagnostic transcriptome can be identified in saliva from patients with various disease conditions. Human salivary mRNA can be used as diagnostic biomarkers for oral and systemic diseases that may be manifested in the oral cavity.
The finding that human RNA can be isolated, amplified, and profiled from cell-free saliva is novel. This discovery advances the concept that saliva has the potential to be a key medium for detecting and monitoring human health and disease. Moreover, this study provides new insights into previously unnoticed biological processes, such as the release and clearance of RNA in saliva. The origin of human mRNA found in saliva remains an important biological question. We will further elucidate whether saliva-based mRNA assays have the needed specificity and sensitivity for reliable diagnostics. Our laboratory is currently enrolling patients with oral squamous cell carcinomas and will investigate the oral-cancer-specific mRNA in saliva as diagnostic markers. We predict that this innovative approach, salivary transcriptome diagnostics (STD), will provide new opportunities for early diagnostics of oral and systemic diseases.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported in part by NIH U01 DE15018 (to D.T. Wong) and by a research grant from the UCLA Jonsson Comprehensive Cancer Center (to D.T. Wong) and a CRFA fellowship (to X. Zhou).
Received for publication October 22, 2003.
Revision received December 24, 2003.
Accepted for publication January 21, 2004.
 |
REFERENCES
|
|---|
- Affymetrix (2001). Affymetrix technical note: new statistical algorithms for monitoring gene expression on GeneChip® Probe Arrays. Santa Clara, CA: Affymetrix.
- Anker P, Mulcahy H, Chen XQ, Stroun M (1999). Detection of circulating tumour DNA in the blood (plasma/serum) of cancer patients. Cancer Metastasis Rev 18:65–73.[CrossRef][Medline]
[Order article via Infotrieve]
- Anker P, Mulcahy H, Stroun M (2003). Circulating nucleic acids in plasma and serum as a noninvasive investigation for cancer: time for large-scale clinical studies? Int J Cancer 103:149–152.[CrossRef][Medline]
[Order article via Infotrieve]
- Bonassi S, Neri M, Puntoni R (2001). Validation of biomarkers as early predictors of disease. Mutat Res 480–481:349–358.
- El-Naggar AK, Mao L, Staerkel G, Coombes MM, Tucker SL, Luna MA, et al. (2001). Genetic heterogeneity in saliva from patients with oral squamous carcinomas: implications in molecular diagnosis and screening. J Mol Diagn 3:164–170.[Abstract/Free Full Text]
- Fleischhacker M, Beinert T, Ermitsch M, Seferi D, Possinger K, Engelmann C, et al. (2001). Detection of amplifiable messenger RNA in the serum of patients with lung cancer. Ann NY Acad Sci 945:179–188.[Medline]
[Order article via Infotrieve]
- Ginzinger D (2002). Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol 30:503–512.[CrossRef][Medline]
[Order article via Infotrieve]
- Kelly JJ, Chernov BK, Tovstanovsky I, Mirzabekov AD, Bavykin SG (2002). Radical-generating coordination complexes as tools for rapid and effective fragmentation and fluorescent labeling of nucleic acids for microchip hybridization. Anal Biochem 311:103–118.[CrossRef][Medline]
[Order article via Infotrieve]
- Kopreski MS, Benko FA, Kwak LW, Gocke CD (1999). Detection of tumor messenger RNA in the serum of patients with malignant melanoma. Clin Cancer Res 5:1961–1965.[Abstract/Free Full Text]
- Lawrence HP (2002). Salivary markers of systemic disease: noninvasive diagnosis of disease and monitoring of general health. J Can Dent Assoc 68:170–174.[Medline]
[Order article via Infotrieve]
- Liao PH, Chang YC, Huang MF, Tai KW, Chou MY (2000). Mutation of p53 gene codon 63 in saliva as a molecular marker for oral squamous cell carcinomas. Oral Oncol 36:272–276.[CrossRef][Medline]
[Order article via Infotrieve]
- Mercer DK, Scott KP, Melville CM, Glover LA, Flint HJ (2001). Transformation of an oral bacterium via chromosomal integration of free DNA in the presence of human saliva. FEMS Microbiol Lett 200:163–167.[CrossRef][Medline]
[Order article via Infotrieve]
- Navazesh M (1993). Methods for collecting saliva. Ann NY Acad Sci 694:72–77.[Medline]
[Order article via Infotrieve]
- Ohyama H, Zhang X, Kohno Y, Alevizos I, Posner M, Wong DT, et al. (2000). Laser capture microdissection-generated target sample for high-density oligonucleotide array hybridization. Biotechniques 29:530–536.[Medline]
[Order article via Infotrieve]
- Pusch W, Flocco MT, Leung SM, Thiele H, Kostrzewa M (2003). Mass spectrometry-based clinical proteomics. Pharmacogenomics 4:463–476.[CrossRef][Medline]
[Order article via Infotrieve]
- Rehak NN, Cecco SA, Csako G (2000). Biochemical composition and electrolyte balance of "unstimulated" whole human saliva. Clin Chem Lab Med 38:335–343.[CrossRef][Medline]
[Order article via Infotrieve]
- Rieger-Christ KM, Mourtzinos A, Lee PJ, Zagha RM, Cain J, Silverman M, et al. (2003). Identification of fibroblast growth factor receptor 3 mutations in urine sediment DNA samples complements cytology in bladder tumor detection. Cancer 98:737–744.[CrossRef][Medline]
[Order article via Infotrieve]
- Sakki T, Knuuttila M (1996). Controlled study of the association of smoking with lactobacilli, mutans streptococci and yeasts in saliva. Eur J Oral Sci 104:619–622.[Medline]
[Order article via Infotrieve]
- Sidransky D (1997). Nucleic acid-based methods for the detection of cancer. Science 278:1054–1059.[Abstract/Free Full Text]
- Sidransky D (2002). Emerging molecular markers of cancer. Nat Rev Cancer 3:210–219.
- St. John MAR, Li Y, Zhou XF, Denny P, Ho CM, Montemagno C, et al. (2004). IL-6 and IL-8: potential biomarkers for oral cavity and oropharyngeal SCCA. Arch Otolaryngol Head Neck Surg (in press).
- Stamey FR, DeLeon-Carnes M, Patel MM, Pellett PE, Dollard SC (2003). Comparison of a microtiter plate system to Southern blot for detection of human herpesvirus 8 DNA amplified from blood and saliva. J Virol Methods 108:189–193.[CrossRef][Medline]
[Order article via Infotrieve]
- Streckfus CF, Bigler LR (2002). Saliva as a diagnostic fluid. Oral Dis 8:69–76.[Medline]
[Order article via Infotrieve]
- Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, et al. (2001). The sequence of the human genome [published erratum appears in Science 292(5523):1838]. Science 291(5507):1304–1351.[Abstract/Free Full Text]
- Wong LJ, Lueth M, Li XN, Lau CC, Vogel H (2003). Detection of mitochondrial DNA mutations in the tumor and cerebrospinal fluid of medulloblastoma patients. Cancer Res 63:3866–3871.[Abstract/Free Full Text]
- Xiang CC, Chen M, Ma L, Phan QN, Inman JM, Kozhich OA, et al. (2003). A new strategy to amplify degraded RNA from small tissue samples for microarray studies. Nucleic Acids Res 31:e53(1–5).[Abstract/Free Full Text]
Journal of Dental Research, Vol. 83, No. 3,
199-203 (2004)
DOI: 10.1177/154405910408300303

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati Twitter What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Huang, H. Li, X. Ding, and C. Xiong
Presence and Characterization of Cell-Free Seminal RNA in Healthy Individuals: Implications for Noninvasive Disease Diagnosis and Gene Expression Studies of the Male Reproductive System
Clin. Chem.,
November 1, 2009;
55(11):
1967 - 1976.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Park, H. Zhou, D. Elashoff, B. S. Henson, D. A. Kastratovic, E. Abemayor, and D. T. Wong
Salivary microRNA: Discovery, Characterization, and Clinical Utility for Oral Cancer Detection
Clin. Cancer Res.,
September 1, 2009;
15(17):
5473 - 5477.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Hu, B. G. Zimmermann, H. Zhou, J. Wang, B. S. Henson, W. Yu, D. Elashoff, G. Krupp, and D. T. Wong
Exon-Level Expression Profiling: A Comprehensive Transcriptome Analysis of Oral Fluids
Clin. Chem.,
May 1, 2008;
54(5):
824 - 832.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Rani, M. Clynes, and L. O'Driscoll
Detection of Amplifiable mRNA Extracellular to Insulin-Producing Cells: Potential for Predicting Beta Cell Mass and Function
Clin. Chem.,
November 1, 2007;
53(11):
1936 - 1944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Lapaire, D. W. Bianchi, I. Peter, B. O'Brien, H. Stroh, J. M. Cowan, U. Tantravahi, and K. L. Johnson
Cell-Free Fetal DNA in Amniotic Fluid: Unique Fragmentation Signatures in Euploid and Aneuploid Fetuses
Clin. Chem.,
March 1, 2007;
53(3):
405 - 411.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. D. Spivack
Clin. Cancer Res.,
February 15, 2007;
13(4):
1351 - 1351.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. V. Kumar, G. J. Hurteau, and S. D. Spivack
Validity of Messenger RNA Expression Analyses of Human Saliva
Clin. Cancer Res.,
September 1, 2006;
12(17):
5033 - 5039.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Park, Y. Li, T. Yu, B. M.N. Brinkman, and D. T. Wong
Characterization of RNA in Saliva
Clin. Chem.,
June 1, 2006;
52(6):
988 - 994.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, D. Elashoff, M. Oh, U. Sinha, M. A.R. St John, X. Zhou, E. Abemayor, and D. T. Wong
Serum Circulating Human mRNA Profiling and Its Utility for Oral Cancer Detection
J. Clin. Oncol.,
April 10, 2006;
24(11):
1754 - 1760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. T. Wong
Salivary diagnostics powered by nanotechnologies, proteomics and genomics
J Am Dent Assoc,
March 1, 2006;
137(3):
313 - 321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, P. Denny, C.-M. Ho, C. Montemagno, W. Shi, F. Qi, B. Wu, L. Wolinsky, and D.T. Wong
The Oral Fluid MEMS/NEMS Chip (OFMNC): Diagnostic & Translational Applications
Advances in Dental Research,
June 1, 2005;
18(1):
3 - 5.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.M. Smoot, J.C. Smoot, H. Smidt, P.A. Noble, M. Konneke, Z.A. McMurry, and D.A. Stahl
DNA Microarrays as Salivary Diagnostic Tools for Characterizing the Oral Cavity's Microbial Community
Advances in Dental Research,
June 1, 2005;
18(1):
6 - 11.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, M. A. R. St. John, X. Zhou, Y. Kim, U. Sinha, R. C. K. Jordan, D. Eisele, E. Abemayor, D. Elashoff, N.-H. Park, et al.
Salivary Transcriptome Diagnostics for Oral Cancer Detection
Clin. Cancer Res.,
December 15, 2004;
10(24):
8442 - 8450.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|