Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Szpaderska, A.M.
Right arrow Articles by DiPietro, L.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Szpaderska, A.M.
Right arrow Articles by DiPietro, L.A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Differential Injury Responses in Oral Mucosal and Cutaneous Wounds

A.M. Szpaderska, J.D. Zuckerman and L.A. DiPietro*

Burn and Shock Trauma Institute, Department of Surgery, Loyola University Medical Center, 2160 S. First Ave., Maywood, IL 60153;

Correspondence: * corresponding author, ldipiet{at}lumc.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Oral mucosa heals faster than does skin, yet few studies have compared the repair at oral mucosal and cutaneous sites. To determine whether the privileged healing of oral injuries involves a differential inflammatory phase, we compared the inflammatory cell infiltrate and cytokine production in wounds of equivalent size in oral mucosa and skin. Significantly lower levels of macrophage, neutrophil, and T-cell infiltration were observed in oral vs. dermal wounds. RT-PCR analysis of inflammatory cytokine production demonstrated that oral wounds contained significantly less IL-6 and KC than did skin wounds. Similarly, the level of the pro-fibrotic cytokine TGF-b1 was lower in mucosal than in skin wounds. No significant differences between skin and mucosal wounds were observed for the expression of the anti-inflammatory cytokine IL-10 and the TGF-β1 modulators, fibromodulin and LTBP-1. These findings demonstrate that diminished inflammation is a key feature of the privileged repair of oral mucosa.

Key Words: wound healing • inflammation • mucosa • skin


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Healing of both oral mucosal and dermal wounds proceeds through the same stages, including hemostasis, inflammation, proliferation, and remodeling of the collagen matrix (Sciubba et al., 1978; Walsh et al., 1996). However, wound healing in the oral mucosa is clinically distinguished from dermal healing in terms of both its rapidity and lack of scar formation. Interestingly, cutaneous wounds in the fetus are also characterized by rapid healing and reduced scar formation (Shah et al., 1995). Fetal wound healing has been studied extensively, and several key features have been identified. Fetal wounds exhibit decreased inflammation, including decreased levels of the pro-inflammatory cytokines IL-6 and IL-8 (Liechty et al., 1998, 2000a). The production of IL-10, an anti-inflammatory cytokine that has been shown to deactivate macrophages, is critical to scarless fetal repair, since wounds of fetal mice lacking IL-10 heal with marked inflammation and scarring (Liechty et al., 2000b).

An additional important difference between fetal and adult wounds is the production of transforming growth factor-β1 (TGF-β1). Compared with adult skin wounds, levels of TGF-β1 are low in fetal wounds. Addition of exogenous TGF-β1 to the fetal wound results in scar formation (Lin et al., 1995), whereas addition of neutralizing antibodies to adult wounds reduces scarring (Shah et al., 1995). TGF-β1 is secreted in a latent form, bound to a latent TGF-β1-binding protein-1 (LTBP-1), and can be activated by plasmin and modulated by fibromodulin. The regulation of TGF-β1 activation may also play a role in modulating repair.

In contrast to the extensive literature on scarless healing in fetal skin, there have been few studies investigating the privileged repair of oral mucosal wounds. To examine differences in oral and skin wound healing, we recently developed equivalent excisional wound models in oral mucosa and skin. To improve our understanding of the mechanism of privileged healing of oral injuries, we compared the inflammatory phases in wounds of oral mucosa and skin, including cellular infiltrate and cytokine production. These studies provide new information about the process of mucosal injury healing, as well as wound healing in general.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Wound Models
All animal procedures were approved by the Loyola University Institutional Animal Care and Use Committee. Female six- to eight-week-old Balb/c mice (Harlan, Inc., Indianapolis, IN, USA) were anesthetized with intraperitoneal pentobarbital injection (50 mg/kg), the dorsal skin was shaved, and 2 excisional dermal and oral mucosal wounds were made by means of a 1-mm punch-biopsy instrument (Acu-Punch, Acuderm Inc., Ft. Lauderdale, FL, USA). Skin wounds were placed on the opposite sides of the midline at the scapula level. Oral mucosal wounds were placed on the dorsal surface of the tongue lateral to the midline. At various intervals after injury, wounds and surrounding tissues were removed, embedded in TBS Tissue Freezing Medium (Triangle Biomedical Sciences, Durham, NC, USA), and stored at –80°C for analysis. For mRNA and myeloperoxidase (MPO) analysis, wounds were harvested with a 3-mm-diameter dermal biopsy punch, snap-frozen, and stored at –80°C. The extent of re-epithelialization was measured as described previously (Swift et al., 1999).

Quantitation of Inflammatory Infiltration
We quantified neutrophil infiltrate by determining the content of a neutrophil-specific enzyme, MPO, in the wound tissue, as described previously (Swift et al., 2001). Wound macrophages and T-cells were quantified by immunohistochemical analysis of wound tissue sections as described previously (Swift et al., 2001). To identify the central portion of the wound, we monitored section width as serial sections were produced and used the widest section. Wound areas were identified by boundaries of the granulation tissue and the inflammatory infiltrate. Macrophages were identified by the use of rat anti-mouse macrophages/monocytes MOMA-2, 1:500 (Serotec Inc., Raleigh, NC, USA), and T-cells were detected with rabbit anti-human anti-CD3 antibody, 1:150 (Dako, Carpinteria, CA, USA). To quantitate macrophages and T-cells, we counted MOMA-2-positive and CD3-positive cells in 10 random high-power fields (HPF) within the wound bed and calculated the average number of cells per HPF. Quantitation of the cells was performed from 6 animals per time point.

RT-PCR
Total RNA was isolated from snap-frozen wounds by means of TRI REAGENT (Sigma, St. Louis, MO, USA) according to the instructions of the manufacturer, treated with DNase I (Invitrogen, Carlsbad, CA, USA), and reverse-transcribed with Omniscript Reverse Transcriptase (Qiagen, Valencia, CA, USA) and an oligo-dT primer (Amersham Pharmacia, Piscataway, NJ, USA) as described previously (Szpaderska and Frankfater, 2001). The optimal number of PCR cycles for each gene of interest and control gene was determined by electrophoretic resolution of PCR products generated at increasing cycle numbers. For each gene, the number of cycles was then set within the exponential phase. The PCR products, obtained from the exponential phase of PCR, were separated by gel electrophoresis and scanned by densitometry. To quantify relative differences in mRNA expression, we corrected densitometry values for each gene to β-actin expression at each time point and normalized them by setting the highest value to 1. Primer sequences were as follow: IL-6 (M20572), 5'GAAAAGAGTTGTGCAATGGCAA3', 5'AAATCTTTTACCTCTTGGTTGA3'; KC (J04596), 5'GCCTATCGCCAATGAGCTGC3', 5'CTTGGGGACACCTTTTAGCATCTTTTGG3'; IL-10 (M37897), 5'GGACTTTAAGGGTTACTTGG3', 5'CACCTTGGTCTTGGAGCATA3'; TGF-β1 (AJ009862), 5'CACCTGCAAGACCATCGACA3', 5'CACGCGGGTGACCTCTTTAG3'; LTBP1 (AF022889), 5'CTGTGCAGATCCTCAGCTGC3', 5'CCACTTCCATCCAGGTAAGG3'; Fibromodulin (X94998), 5'TGACACAACATGATCTGCAC3', 5'TTCTTGCACCCCAGTGAGCA3'; and β-actin (X03672), 5'GTGGGCCGCCCTAGGCACCA3', 5'CTCTTTGATGTCACGCACGATTTC3'.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Inflammatory Infiltrate in Dermal and Oral Mucosal Wounds
Because reduced wound inflammation is associated with improved tissue repair (Wetzler et al., 2000), we examined inflammatory cell infiltration in our model of excisional oral mucosal and skin wounds. Neutrophil infiltration, as measured by the determination of specific MPO activity in wound homogenates, was observed as early as 4 hrs post-injury in both injury sites (0.25 ± 0.06 vs. 0.85 ± 0.16), peaking at 24 hrs (1.26 ± 0.2 vs. 2.82 ± 0.2) (Fig. 1AGo). Whereas neutrophil infiltration followed the same time course in both sites of injury, there were significantly lower numbers of neutrophils in the oral wounds at all time points.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
Figure 1. Inflammatory cell infiltrate in excisional wounds in oral mucosa and skin. (A) Neutrophil content as measured by total wound MPO level. Each bar represents the mean ± SE of 6 independent measurements. (B) The mean macrophage number per high power field (HPF) ± SE in wounds. Macrophage infiltration was analyzed by immunohistochemical staining of wound sections and quantitation of MOMA-2 immunopositive cells (n = 6). **p < 0.01; ***p < 0.001 by Student’s t test.

 
Macrophage infiltration, with the use of immunohistochemical staining, also exhibited a significant decrease in oral mucosal wounds at 24 hrs post-injury (6.4 ± 0.5 vs. 16.7 ± 0.9, macrophages/HPF, p < 0.001), and at 72 hrs post-injury (6.7 ± 0.4 vs. 10.8 ± 0.3, macrophages/HPF, p < 0.01) (Fig. 1BGo). In the skin wounds, maximal macrophage counts were observed 24 hrs post-injury, with levels declining at 48 and 72 hrs. In oral wounds, the peak of macrophage infiltration was seen at 48 hrs, with declining cell numbers at 72 hrs. Similar to macrophages and neutrophils, T-cell content in wounds was also significantly decreased in oral mucosal wounds (5.6 ± 0.3 vs. 15.1 ± 1.5, p < 0.005) on day 7 post-injury (data not shown). Analysis of these data, taken together, shows that, compared with dermal wounds, the inflammatory phase of oral mucosal wounds is reduced.

Cytokine Expression in Oral and Dermal Wounds
Because inflammatory cell recruitment into oral mucosal wounds was diminished, we compared the expression patterns of pro- and anti-inflammatory cytokines. RT-PCR analysis was carried out on RNA isolated from normal, uninjured mucosa and skin, and from mucosal and skin wounds at multiple times post-injury. In mucosal wounds, IL-6 levels were elevated for just 24 hrs after wounding occurred (Figs. 2AGo, 2DGo), while levels of KC, a murine homolog of human interleukin-8 (IL-8), were elevated for only 12 hrs (Figs. 2BGo, 2DGo). In skin wounds, both IL-6 and KC mRNA levels were elevated for 72 hrs. Although significant differences in IL-6 and KC expression were noted (p < 0.0001), IL-10, another cytokine implicated in scarless fetal healing, failed to show differential expression in mucosal and skin wounds (Figs. 2CGo, 2DGo). The results demonstrate that oral and dermal wound healing are characterized by different patterns of pro-inflammatory mediator production.


Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
Figure 2. RT-PCR of IL-6, KC, and IL-10. RT-PCR was performed on RNA isolated from normal tissues or wound samples at indicated times post-injury. To determine relative changes in mRNA levels during development, we corrected densitometry values for each gel to β actin expression at each time and normalized them by setting the highest value to 1. (A–C) The results are depicted graphically as the mean ± SE; n = 3. Data were analyzed by two-way ANOVA and Bonferroni’s post-test. (D) A representative PCR is shown. NS = normal skin.

 
TGF-β1 Expression in Oral Mucosal and Cutaneous Wounds
RT-PCR analysis of steady-state mRNA levels in oral wounds showed significantly reduced TGF-β1 expression when compared with skin wounds (Figs. 3AGo, 3DGo). TGF-β1 was down-regulated in oral mucosa at all time points post-injury. No significant difference was detected in the expression of LTBP-1, a modulator of TGF-β1 activity (Figs. 3BGo, 3DGo). The mean fibromodulin mRNA levels were higher in oral than in dermal wounds; however, there was no statistical significance (Figs. 3CGo, 3DGo).


Figure 3
View larger version (26K):
[in this window]
[in a new window]

 
Figure 3. RT-PCR of TGF-β1, LTBP-1, and fibromodulin. RT-PCR was performed on RNA isolated from normal tissues or wound samples at indicated times post-injury. To determine relative changes in mRNA levels during development, we corrected densitometry values for each gel to β actin expression at each time and normalized them by setting the highest value to 1. (A–C) The results are depicted graphically as the mean ± SE; n = 3. Data were analyzed by two-way ANOVA and Bonferroni’s post-test. (D) A representative PCR is shown. NS = normal skin.

 
Comparison of Wound Closure
To investigate the site-specific differences in the proliferative phase of healing, we quantified re-epithelialization of the wounds by morphometric analysis. Dermal wounds were only 40% re-epithelialized at 24 hrs post-injury (Figs. 4AGo, 4BGo) and did not achieve closure until 60 hrs (Figs. 4CGo, 4DGo). In contrast, re-epithelialization occurred very rapidly in the oral wounds, with 100% re-epithelialization at 24 hrs post-injury (Figs. 4EGo, 4FGo).


Figure 4
View larger version (104K):
[in this window]
[in a new window]

 
Figure 4. Wound histology and re-epithelialization. White arrows demarcate wound margins. Black boxes on low power (A,C,E) indicate the region shown in the right panels. (A) Partially re-epithelialized dermal wound 24 hrs after injury. (B) The boxed region shows the advancing edge of the epithelium (yellow arrow). (C,D) Fully re-epithelialized dermal wound at 60 hrs post-injury, at 10x and 20x, respectively. (E,F) The oral mucosal wound shows complete re-epithelialization by 24 hrs after injury, 10x and 20x, respectively.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study was designed to determine if alterations in inflammation might be a feature of privileged wound healing in oral mucosa. Incisional murine wound models have been described previously; however, because the mouse is small, it is technically difficult to produce excisional wounds on its buccal or gingival mucosa. An excisional wound model was preferred for this study, since the inflammatory process is much more robust in excisional than incisional wounds. Thus, we have chosen the tongue as a site of intra-oral injury, since it gave the best reproducibility and adequate space for an excisional wound. Additionally, the dorsal surface of the tongue is covered with keratinized epithelium, similar to skin. The inflammatory reaction of oral incisional wounds of healthy mucosa has been rather generally described as less robust than that of comparable skin wounds (Sciubba et al., 1978). However, the inflammatory cell infiltrate and cytokine profile of oral mucosal wounds had never been compared with those of skin wounds. In comparison with skin wounds, several remarkable changes in the inflammatory process were seen in oral mucosal wounds. Lower neutrophil, macrophage, and T-cell infiltrations were consistently observed in the intra-oral injury site. This finding was reminiscent of previous descriptions of rapidly healing fetal wounds, a circumstance in which neutrophils, macrophages, and lymphocytes are virtually absent (Adzick et al., 1985).

Previous studies of dermal wounds have suggested that a robust neutrophil infiltrate may be dispensable or even detrimental to wound healing, and thus the finding of reduced neutrophil infiltration in oral wounds is in keeping with the accelerated repair (Wetzler et al., 2000). In contrast, macrophages have been shown to play a critical role in tissue repair in the adult (Leibovich and Ross, 1975). In adult skin, macrophages are recruited to sites of injury, where they produce multiple growth factors that stimulate collagen synthesis and fibroplasia (DiPietro, 1995; DiPietro et al., 1998). The surprising finding of reduced macrophages in oral mucosal wounds suggests the possibility that the role of macrophages is dissimilar in adult skin and mucosal wounds. One possibility is that within the oral cavity, saliva provides many necessary growth factors, making macrophage function less critical.

Our observation of fewer inflammatory cells in oral wounds was supported by the measurement of decreased cytokine production in these wounds. Diminished production of IL-6 and KC in oral mucosal wounds may be responsible for the reduced recruitment of neutrophils and macrophages. Similar to changes in inflammatory cytokines, we also saw differences in the expression of TGF-β1, a pro-inflammatory, pro-fibrotic cytokine that has been implicated in hypertrophic scars (Wang et al., 2000). Non-scarring fetal dermal wounds show markedly reduced TGF-β1 expression when compared with adult wounds (Cowin et al., 2001), and analysis of our data shows that TGF-β1 expression in the wound bed is significantly lower in oral mucosa than in the skin.

While oral mucosal wounds exhibited many similarities to non-scarring, rapidly healing fetal wounds, the healing processes of fetal skin and mucosal wounds are certainly not identical. When compared with adult skin wounds, lower expression of two modulators of TGF-β1, LTBP and fibromodulin, has been described in fetal skin wounds. In contrast, no change in these modulators was observed between adult skin and oral mucosal wounds. Interleukin-10, an anti-inflammatory cytokine that is increased in fetal vs. adult skin wounds, also showed no change in oral wounds.

Many previous studies have suggested that saliva—containing abundant amounts of cytokines, growth factors, and protease inhibitors—is the primary factor that accounts for rapid oral wound healing (Zelles et al., 1995; Ashcroft et al., 2000). Sialoadenectomized mice and rats have been observed to exhibit delayed healing of oral wounds (Hutson et al., 1979; Bodner et al., 1992). However, other studies provide evidence that the presence of saliva is not the only factor responsible for the rapid healing of oral wounds. In desalivated rats, large palatal wounds were sensitive to desalivation, whereas small wounds healed similarly to controls (Bodner et al., 1993). Oral administration of EGF in sialoadenectomized mice restored the rate of wound healing to normal levels (Noguchi et al., 1991). Bussi and co-workers reported that skin transposed into the oral cavity maintained its morphologic characteristics, such as keratinization, hair follicles, and sweat glands, and showed an intense inflammatory reaction on dermis, while Reilly and co-workers observed an intra-oral keloid in transposed skin (Reilly et al., 1980; Magrano et al., 1995). Therefore, while saliva may exert some beneficial effects, saliva alone cannot induce adult skin to heal without scar. These findings suggest that the rapid healing and the absence of scars in oral mucosa are most directly related to intrinsic characteristics of the tissue and not to environmental factors such as temperature, salivary flow, the absence of a hemostatic plug, or microflora.

Interestingly, there is strong evidence that scarless dermal wound healing in the early fetus is also primarily intrinsic, and is not derived from the sterile, aqueous intra-uterine environment. Adult skin transplanted onto a fetus heals with scar formation (Longaker et al., 1994), and human fetal skin heals without scar formation when it is transplanted to a subcutaneous location on an adult athymic mouse (Lorenz et al., 1992). The differences between fetal and adult skin wound healing appear to reflect processes intrinsic to fetal tissue, particularly a markedly reduced inflammatory infiltrate and cytokine profile. Based on our experiments, we suggest that healing of mucosal wounds parallels that of fetal wound repair, and that the relatively scarless repair of oral mucosa is derived primarily from intrinsic differences in oral mucosal tissue rather than from the site environment. Our studies and those of others (Yang et al., 1996) document that oral wounds close more rapidly. Our findings imply that an altered inflammatory response may be an important facet of this rapid oral healing, and provide a possible explanation for the altered repair response that is observed in oral mucosa.

Our present studies cannot determine whether the more rapid healing of mucosa leads to reduced inflammation or whether, instead, a decreased intrinsic inflammatory response allows for more rapid healing. However, the fact that inflammation occurs quickly, and before wound closure begins, favors the latter hypothesis. One candidate factor that might be involved in the reduction of inflammation in oral wounds is secretory leukocyte protease inhibitor, an anti-inflammatory factor found in mucosa (Ashcroft et al., 2000). Interestingly, several recent studies support the concept that reduced inflammation can accelerate normal skin repair (Ashcroft et al., 2000; Dovi et al., 2003; Wilgus et al., 2003). The mechanism by which inflammation is reduced in oral wounds and the exact role of this reduced inflammation in permitting rapid and more scarless repair require further study.


    ACKNOWLEDGMENTS
 
This work was supported by US Public Health Service Grants GM50875 and GM55238 (to L.A.D.) and by US Public Health Service Training Grant T32-AI07508 (to A.M.S.).

Received for publication December 17, 2002. Revision received April 10, 2003. Accepted for publication May 30, 2003.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Adzick NS, Harrison MR, Glick PL, Beckstead JH, Villa RL, Scheuenstuhl H, et al. (1985). Comparison of fetal, newborn, and adult wound healing by histologic, enzyme-histochemical, and hydroxyproline determinations. J Pediatr Surg 20:315–319.[CrossRef][Medline] [Order article via Infotrieve]
  • Ashcroft GS, Lei K, Jin W, Longenecker G, Kulkarni AB, Greenwell-Wild T, et al. (2000). Secretory leukocyte protease inhibitor mediates non-redundant functions necessary for normal wound healing. Nat Med 6:1147–1153.[CrossRef][Medline] [Order article via Infotrieve]
  • Bodner L, Dayan D, Oberman M, Hirshberg A, Tal H (1992). Healing of experimental wounds in sialadenectomized rat. J Clin Periodontol 19:345–347.[CrossRef][Medline] [Order article via Infotrieve]
  • Bodner L, Dayan D, Pinto Y, Hammel I (1993). Characteristics of palatal wound healing in desalivated rats. Arch Oral Biol 38:17–21.[CrossRef][Medline] [Order article via Infotrieve]
  • Magrano M, Bussi M, De Stefani A, Milan F, Lerda W, Ferrero V, et al. (1995). Prognostic factors for head and neck tumor recurrence. Acta Otolaryngol 115:833–838.[Medline] [Order article via Infotrieve]
  • Cowin AJ, Holmes TM, Brosnan P, Ferguson MW (2001). Expression of TGF-beta and its receptors in murine fetal and adult dermal wounds. Eur J Dermatol 11:424–431.[Medline] [Order article via Infotrieve]
  • DiPietro LA (1995). Wound healing: the role of the macrophage and other immune cells. Shock 4:233–240.[Medline] [Order article via Infotrieve]
  • DiPietro LA, Burdick M, Low QE, Kunkel SL, Strieter RM (1998). MIP-1alpha as a critical macrophage chemoattractant in murine wound repair. J Clin Invest 101:1693–1698.[Medline] [Order article via Infotrieve]
  • Dovi JV, He LK, DiPietro LA (2003). Accelerated wound closure in neutrophil-depleted mice. J Leukoc Biol 73:448–455.[Abstract/Free Full Text]
  • Hutson JM, Niall M, Evans D, Fowler R (1979). Effect of salivary glands on wound contraction in mice. Nature 279:793–795.[CrossRef][Medline] [Order article via Infotrieve]
  • Leibovich SJ, Ross R (1975). The role of the macrophage in wound repair. A study with hydrocortisone and antimacrophage serum. Am J Pathol 78:71–100.[Abstract]
  • Liechty KW, Crombleholme TM, Cass DL, Martin B, Adzick NS (1998). Diminished interleukin-8 (IL-8) production in the fetal wound healing response. J Surg Res 77:80–84.[CrossRef][Medline] [Order article via Infotrieve]
  • Liechty KW, Adzick NS, Crombleholme TM (2000a). Diminished interleukin 6 (IL-6) production during scarless human fetal wound repair. Cytokine 12:671–676.[CrossRef][Medline] [Order article via Infotrieve]
  • Liechty KW, Kim HB, Adzick NS, Crombleholme TM (2000b). Fetal wound repair results in scar formation in interleukin-10-deficient mice in a syngeneic murine model of scarless fetal wound repair. J Pediatr Surg 35:866–872; discussion 872–863.[CrossRef][Medline] [Order article via Infotrieve]
  • Lin RY, Sullivan KM, Argenta PA, Meuli M, Lorenz HP, Adzick NS (1995). Exogenous transforming growth factor-beta amplifies its own expression and induces scar formation in a model of human fetal skin repair. Ann Surg 222:146–154.[Medline] [Order article via Infotrieve]
  • Longaker MT, Whitby DJ, Ferguson MW, Lorenz HP, Harrison MR, Adzick NS (1994). Adult skin wounds in the fetal environment heal with scar formation. Ann Surg 219:65–72.[Medline] [Order article via Infotrieve]
  • Lorenz HP, Longaker MT, Perkocha LA, Jennings RW, Harrison MR, Adzick NS (1992). Scarless wound repair: a human fetal skin model. Development 114:253–259.[Abstract]
  • Noguchi S, Ohba Y, Oka T (1991). Effect of salivary epidermal growth factor on wound healing of tongue in mice. Am J Physiol 260:E620–E625.
  • Reilly JS, Behringer WH, Trocki I (1980). Intraoral keloid: complication of forehead flap. Otolaryngol Head Neck Surg 88:139–141.[Medline] [Order article via Infotrieve]
  • Sciubba JJ, Waterhouse JP, Meyer J (1978). A fine structural comparison of the healing of incisional wounds of mucosa and skin. J Oral Pathol 7:214–227.[CrossRef][Medline] [Order article via Infotrieve]
  • Shah M, Foreman DM, Ferguson MW (1995). Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring. J Cell Sci 108:985–1002.[Abstract]
  • Swift ME, Kleinman HK, DiPietro LA (1999). Impaired wound repair and delayed angiogenesis in aged mice. Lab Invest 79:1479–1487.[Medline] [Order article via Infotrieve]
  • Swift ME, Burns AL, Gray KL, DiPietro LA (2001). Age-related alterations in the inflammatory response to dermal injury. J Invest Dermatol 117:1027–1035.[CrossRef][Medline] [Order article via Infotrieve]
  • Szpaderska AM, Frankfater A (2001). An intracellular form of cathepsin B contributes to invasiveness in cancer. Cancer Res 61:3493–3500.[Abstract/Free Full Text]
  • Walsh LJ, L’Estrange PR, Seymour GJ (1996). High magnification in situ viewing of wound healing in oral mucosa. Aust Dent J 41:75–79.[Medline] [Order article via Infotrieve]
  • Wang R, Ghahary A, Shen Q, Scott PG, Roy K, Tredget EE (2000). Hypertrophic scar tissues and fibroblasts produce more transforming growth factor-beta1 mRNA and protein than normal skin and cells. Wound Repair Regen 8:128–137.[Medline] [Order article via Infotrieve]
  • Wetzler C, Kampfer H, Stallmeyer B, Pfeilschifter J, Frank S (2000). Large and sustained induction of chemokines during impaired wound healing in the genetically diabetic mouse: prolonged persistence of neutrophils and macrophages during the late phase of repair. J Invest Dermatol 115:245–253.[CrossRef][Medline] [Order article via Infotrieve]
  • Wilgus TA, Vodovotz Y, Vittadini E, Clubbs EA, Oberyszyn TM (2003). Reduction of scar formation in full-thickness wounds with topical celecoxib treatment. Wound Repair Regen 11:25–34.[CrossRef][Medline] [Order article via Infotrieve]
  • Yang J, Tyler LW, Donoff RB, Song B, Torio AJ, Gallagher GT, et al. (1996). Salivary EGF regulates eosinophil-derived TGF-alpha expression in hamster oral wounds. Am J Physiol 270:G191–G202.
  • Zelles T, Purushotham KR, Macauley SP, Oxford GE, Humphreys-Beher MG (1995). Saliva and growth factors: the fountain of youth resides in us all. J Dent Res 74:1826–1832.

Journal of Dental Research, Vol. 82, No. 8, 621-626 (2003)
DOI: 10.1177/154405910308200810


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
M. J. Oudhoff, K. L. Kroeze, K. Nazmi, P. A. M. van den Keijbus, W. van 't Hof, M. Fernandez-Borja, P. L. Hordijk, S. Gibbs, J. G. M. Bolscher, and E. C. I. Veerman
Structure-activity analysis of histatin, a potent wound healing peptide from human saliva: cyclization of histatin potentiates molar activity 1000-fold
FASEB J, November 1, 2009; 23(11): 3928 - 3935.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
S. Enoch, I. Wall, M. Peake, L. Davies, J. Farrier, P. Giles, D. Baird, D. Kipling, P. Price, R. Moseley, et al.
Increased Oral Fibroblast Lifespan Is Telomerase-independent
Journal of Dental Research, October 1, 2009; 88(10): 916 - 921.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
A. Eslami, C. L. Gallant-Behm, D. A. Hart, C. Wiebe, D. Honardoust, H. Gardner, L. Hakkinen, and H. S. Larjava
Expression of Integrin {alpha}v{beta}6 and TGF-{beta} in Scarless vs Scar-forming Wound Healing
J. Histochem. Cytochem., June 1, 2009; 57(6): 543 - 557.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. J. Kaitu'u-Lino, D. J. Phillips, N. B. Morison, and L. A. Salamonsen
A New Role for Activin in Endometrial Repair after Menses
Endocrinology, April 1, 2009; 150(4): 1904 - 1911.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Meran, D. W. Thomas, P. Stephens, S. Enoch, J. Martin, R. Steadman, and A. O. Phillips
Hyaluronan Facilitates Transforming Growth Factor-{beta}1-mediated Fibroblast Proliferation
J. Biol. Chem., March 7, 2008; 283(10): 6530 - 6545.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
K. Gronert
Lipid Autacoids in Inflammation and Injury Responses: A Matter of Privilege
Mol. Interv., February 1, 2008; 8(1): 28 - 35.
[Abstract] [Full Text] [PDF]


Home page
Psychosom. Med.Home page
J. A. Bosch, C. G. Engeland, J. T. Cacioppo, and P. T. Marucha
Depressive Symptoms Predict Mucosal Wound Healing
Psychosom Med, September 1, 2007; 69(7): 597 - 605.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Meran, D. Thomas, P. Stephens, J. Martin, T. Bowen, A. Phillips, and R. Steadman
Involvement of Hyaluronan in Regulation of Fibroblast Phenotype
J. Biol. Chem., August 31, 2007; 282(35): 25687 - 25697.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. K. Inder, N. Ueda, A. A. Mercer, S. B. Fleming, and L. M. Wise
Bovine papular stomatitis virus encodes a functionally distinct VEGF that binds both VEGFR-1 and VEGFR-2
J. Gen. Virol., March 1, 2007; 88(3): 781 - 791.
[Abstract] [Full Text] [PDF]


Home page
Arch SurgHome page
C. G. Engeland, J. A. Bosch, J. T. Cacioppo, and P. T. Marucha
Mucosal Wound Healing: The Roles of Age and Sex
Arch Surg, December 1, 2006; 141(12): 1193 - 1197.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. J. Velardo, C. Burger, P. R. Williams, H. V. Baker, M. C. Lopez, T. H. Mareci, T. E. White, N. Muzyczka, and P. J. Reier
Patterns of Gene Expression Reveal a Temporally Orchestrated Wound Healing Response in the Injured Spinal Cord
J. Neurosci., September 29, 2004; 24(39): 8562 - 8576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Sukotjo, A. Lin, K. Song, T. Ogawa, B. Wu, and I. Nishimura
Oral Fibroblast Expression of wound-inducible transcript 3.0 (wit3.0) Accelerates the Collagen Gel Contraction in Vitro
J. Biol. Chem., December 19, 2003; 278(51): 51527 - 51534.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Szpaderska, A.M.
Right arrow Articles by DiPietro, L.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Szpaderska, A.M.
Right arrow Articles by DiPietro, L.A.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?