|
Sign In to gain access to subscriptions and/or personal tools.
|
Relative Levels of mRNA Encoding Enamel Proteins in Enamel Organ Epithelia and Odontoblasts
T. Nagano1,*,
S. Oida2,
H. Ando2,
K. Gomi1,
T. Arai1 and
M. Fukae2
1 Department of Periodontics and Endodontics and
2 Department of Biochemistry, School of Dental Medicine, Tsurumi University, 2-1-3 Tsurumi, Tsurumi-ku, Yokohama 230-8501, Japan;
Correspondence: *corresponding author, nagano-takatoshi{at}tsurumi-u.ac.jp
 |
ABSTRACT
|
|---|
Amelogenin, enamelin, sheathlin (ameloblastin/ amelin), enamelysin (MMP-20), and KLK4 (EMSP-1) are the major structural proteins and proteinases in developing tooth enamel. Recently, odontoblasts were reported to express amelogenin, the most abundant enamel protein. In this study, we hypothesized that odontoblasts express all enamel proteins and proteases, and we measured their relative mRNA levels in enamel organ epithelia and odontoblasts associated with porcine secretory- and maturation-stage enamel by RT-PCR, using a LightCycler instrument. The results showed that amelogenin mRNA in secretory-stage EOE is 320-fold higher than in odontoblasts beneath secretory-stage enamel, and over 20,000-fold higher than in odontoblasts under maturation-stage enamel. Similar results were obtained for enamelin and sheathlin. Enamelysin mRNA levels were equivalent in these two tissues, while KLK4 mRNA was higher in odontoblasts than in secretory-stage EOE. These results support the conclusion that odontoblasts are involved in the formation of the enamel layer adjacent to enamel-dentin junction.
Key Words: amelogenin enamelysin KLK4 odontoblasts ameloblasts
 |
INTRODUCTION
|
|---|
During amelogenesis, enamel proteins and their cleavage products form the enamel matrix and are involved in controlling crystal growth. Amelogenin is the most abundant enamel protein during the secretory stage of amelogenesis (Termine et al., 1980). Enamelin is the largest glycoprotein secreted into the matrix (Hu et al., 1997b), while sheathlin cleavage products (Fukae and Tanabe, 1987) concentrate in the sheath space between the rod and interrod enamel (Uchida et al., 1995; Hu et al., 1997a). Amelin (Cerny et al., 1996) and ameloblastin (Krebsbach et al., 1996), first cloned from rat-tooth-specific cDNA libraries, are homologs of porcine sheathlin.
With the technique of in situ hybridization, amelogenin mRNA can be clearly detected in pre-ameloblasts, with the maximum signal being observed in secretory-stage ameloblasts (Inage et al., 1996). Similarly, enamelin signal is detected in ameloblasts but not in odontoblasts or dental pulp (CC Hu et al., 2000). Sheathlin signal is detected in pre-odontoblasts, polarizing odontoblasts, and ameloblasts (Bègue-Kirn et al., 1998). Recently, it was proved by reverse-transcription/polymerase chain-reaction (RT-PCR), with a LightCycler instrument, that the amelogenin mRNA is expressed by odontoblasts, even in erupted young first molar in the root-forming stage (Oida et al., 2002).
There are two proteinases—enamelysin (MMP-20) (Bartlett et al., 1996; Fukae et al., 1998) and kallikrein-4 (KLK4), also known as enamel matrix serine proteinase-1 (EMSP-1) (Simmer et al., 1998)—involved in the degradation of amelogenin. Enamelysin participates in the conversion from 25-kDa amelogenin to 20-kDa amelogenin (Fukae and Tanabe, 1998). KLK4 is a proteolytic enzyme that was first detected in porcine enamel (Fukae et al., 1977), and degrades the 20-kDa amelogenin into two fragments, corresponding to the 6-kDa and 13-kDa amelogenins (Shimizu and Fukae, 1983). Enamelysin mRNA has been detected in odontoblasts and ameloblasts of the enamel organ by in situ hybridization (Bègue-Kirn et al., 1998; Fukae et al., 1998; Caterina et al., 1999). KLK4 mRNA signal was detected in the ameloblasts during the early maturation stage by in situ hybridization (JC Hu et al., 2000). Localization of mRNA encoding enamel proteins and proteinases in the developmental tooth germs by in situ hybridization may miss low levels of expression in tissues adjacent to those having high levels of expression, since development times must be reduced to prevent overexposure of the signal in the high-level tissue. In this study, we examined, semi-quantitatively, enamel protein mRNA levels in several cell layers at different developmental stages of porcine permanent tooth germs.
 |
MATERIALS & METHODS
|
|---|
All experimental procedures involving the use of animals was reviewed and approved by the Institutional Animal Care Program at the Tsurumi University.
Isolation of Tissues
Fresh permanent tooth germs were dissected from six-month-old porcine mandibles purchased from a local slaughterhouse. We prepared various cell layers according to the schematic drawing shown in Fig. 1 . The secretory and maturation enamel organ epithelia (EOE) layers were collected separately from the labial site of the developing incisor enamel (Oida et al., 2002). We also prepared 2 odontoblast cell layers, taking care to avoid contamination by ameloblasts. Following removal of the EOE and dental pulp (odontoblasts remain attached to the hard tissue when the dental papilla is removed), we divided the tooth into 2 pieces at the position of the transition-stage enamel by cutting it with a dental diamond disc attached to a dental engine (Morita Corporation, Tokyo, Japan). Odontoblasts lining dentin (Oida et al., 2002) under the secretory and maturation stages of developmental enamel were collected separately by being washed with a phosphate-buffered solution and being scraped with a micro-spatula; these were designated young and mature odontoblasts, respectively. Two additional samples were prepared from the removed dental pulp. The surface-side cells were collected as the pre-odontoblast layer, and the remaining pulp tissue was collected as dental pulp cells.

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1. Schematic drawing of ameloblast and odontoblast tissue preparations. SA, secretory ameloblast (enamel organ epithelia; EOE) layer; MA, maturation ameloblast (EOE) layer; YO, young odontoblast layer; MO, mature odontoblast layer.
|
|
Histochemistry
Each tissue sample was immersed in 10% formalin. After fixation, the specimens were embedded in Tecknobit. The mineralized tissues were demineralized before being embedded. Sections (4 µm thick) were mounted on glass slides and stained with Mayers hematoxylin and eosin.
RNA Preparation
Total RNA of each cell layer sample was obtained with the Stratagene Total RNA Miniprep Kit and protocol (Stratagene, La Jolla, CA, USA).
Reverse-transcription/Polymerase Chain-reaction (RT-PCR)
Single-strand cDNA was prepared from 3 µg of each total RNA sample by means of a Pharmacia Ready-to-go T-primed first kit and protocol (Amersham-Pharmacia Biotech, Piscataway, NJ, USA). PCR conditions (Perkin-Elmer/GeneAmp PCR system 9600) were as follows: PCR began with a 10-minute denaturation at 94°C, followed by 25 cycles with denaturation at 94°C for 30 sec, primer annealing at 55°C for 30 sec, and product extension at 72°C for 30 sec; in the final cycle, the 72°C extension was for 7 min. PCR products were analyzed by 4.5% polyacrylamide gel electrophoresis in TBE buffer (pH 8.0). Gels were stained with ethidium bromide, and the bands were visualized under UV light. Additionally, the PCR products were cloned into pBluescriptIISK(+) (Stratagene, La Jolla, CA, USA), and their nucleotide sequences were determined by cycle sequencing.
Semi-quantitative PCR with the LightCycler Instrument
Specific primers of enamel proteins and proteinases were designed based on porcine and mouse mRNA sequences. The amelogenin sense and anti-sense primers were: 5 ACCCCTCTGAAGTGGTACCAG 3 and 5 TGTTGGGTTGGAGTCATGGAG 3, which generated a 236-bp amplification product. The enamelin sense and anti-sense primers were: 5 AAGAACTGCTGGCCTTACTCC 3 and 5 TCCCCAAAGAATGTTTGGTTG 3, which generated a 433-bp amplification product. The sheathlin sense and anti-sense primers were: 5 CAGAGGTAGCATCTGGGTGTCC 3 and 5 CTCTCAGGGCTCTTGGAAACG 3, which generated a 320-bp amplification product. The enamelysin sense and anti-sense primers were: 5 ATACGTGCAGCGAATAGATGC 3 and 5 CTATTTAGCAACCAATCCAGG 3', which generated a 290-bp amplification product. The KLK4 sense and anti-sense primers were: 5 ACCATGGGCGAGGACTGCAA 3 and 5 GTTAACTGGCCTGGATGGTCG 3, which generated a 673-bp amplification product. A primer set amplifying glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Clontech, Palo Alto, CA, USA) was used as a control.
The cDNAs generated from each EOE and odontoblast sample were amplified by means of the DNA Master SYBR Green I kit and protocol and a LightCycler instrument (Roche Molecular Biochemicals, Mannheim, Germany). The relative amount of each mRNA was determined at 50% levels of PCR product, and normalized with use of the relative amount of GAPDH mRNA.
 |
RESULTS
|
|---|
To examine the relative levels of mRNA encoding enamel proteins and their related proteinases in the various tissues in developing teeth, we prepared several cell layer samples from the soft tissues surrounding the immature permanent tooth germs (Fig. 1 ). It was shown histologically that the secretory-stage EOE sample contained secretory ameloblasts, from 4 to 6 cell layers of stratum intermedium-like cells, and a thick layer of stellate reticulum. In contrast, the odontoblast samples contained mostly odontoblasts (Oida et al., 2002; data not shown). Fig. 2 shows PCR products of amelogenin, enamelin, sheathlin, enamelysin, and KLK4, after 25 cycles of standard PCR, normalized to GAPDH, and then visualized on polyacrylamide gels stained with ethidium bromide. The mRNAs encoding the structural enamel proteins were found more or less in both the EOE and odontoblast samples. Although some of these mRNAs were not detected by gel electrophoresis, their presence in these tissues was evident when the LightCycler system was used (Fig. 3 ). However, the PCR products of enamel structural proteins were not detected in the pre-odontoblast cell layers (PO) and dental pulp cells (DP) after as many as 40 cycles of PCR (data not shown). The DSPP PCR product, which was the marker for odontoblasts, was found only in young and mature odontoblast layer samples (data not shown). DNA sequencing of the PCR products from the EOE and odontoblast samples proved that they were the appropriate gene products (data not shown).

View larger version (59K):
[in this window]
[in a new window]
|
Figure 2. Detection of mRNAs encoding GAPDH, amelogenin, enamelin, sheathlin, enamelysin, and KLK4 after 25 cycles of RT-PCR. Amelogenin, enamelin, sheathlin, enamelysin, and KLK4 PCR products were amplified from the cDNA template and separated by electrophoresis on a 4.5% polyacrylamide gel. M, molecular-size standard, PhiX174 DNA-Hae III (New England Biolabs); SA, secretory ameloblast layer; MA, maturation ameloblast layer; YO, young odontoblast layer; MO, mature odontoblast layer; PO, pre-odontoblast layer; DP, dental pulp cells; EO, erupted first molar odontblast layer.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Figure 3. Quantitative PCR of amelogenin, enamelin, sheathlin, enamelysin, KLK4, and GAPDH mRNAs isolated from the various cell layer samples. SA, secretory ameloblast layer; MA, maturation ameloblast layer; YO, young odontoblast layer; MO, mature odontoblast layer. The most typical pattern was shown. The vertical axis shows relative amounts, and the horizontal axis shows cycles.
|
|
Based on the relative amounts of enamel proteins mRNA, identified by LightCycler PCR, the ratio of each gene product was calculated after normalization to the amount of the GAPDH signal (Fig. 4 ). The ratio of amelogenin mRNA for secretory EOE (SA), maturation EOE (MA), young odontoblast (YO), and mature odontoblast (MO) samples was 4096:2:64:1. Ameloblasts constituted 20% of secretory EOE (Oida et al., 2002). We would estimate from these results that the ratio of amelogenin mRNA for secretory EOE (SA), maturation EOE (MA), young odontoblast (YO), and mature odontoblast (MO) samples was 20480:2:64:1. The ratios for enamelin and sheathlin mRNA in these same tissues were similar to those of amelogenin, although their values in the secretory EOE layer were lower. Both enamelysin and KLK4 mRNA were also expressed in the ameloblast and odontoblast samples. Based on the amounts of the GAPDH mRNA, the ratio of enamelysin mRNA for secretory EOE, maturation EOE, young odontoblast, and mature odontoblast samples was 16:1:32:24, while the ratio for KLK4 was 1:32:16:12.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 4. The relative amounts of amelogenin (A), enamelin (B), sheathlin (C), enamelysin (D), and KLK4 (E) mRNA in the cell layer samples, after normalization with the amounts of the GAPDH mRNA. SA, secretory ameloblast layer; MA, maturation ameloblast layer; YO, young odontoblast layer; MO, mature odontoblast layer. The vertical axis shows relative amounts. The results were expressed as means ± SD of three samples.
|
|
 |
DISCUSSION
|
|---|
All structural enamel proteins were expressed in both the EOE and odontoblast cell layer samples, and the relative amounts of their mRNAs in the various cell layer samples were normalized for sample size based on GAPDH mRNA levels. While GAPDH mRNA would have been contributed by all types of cells in the EOE samples, amelogenin mRNA is believed to be expressed only by the ameloblast layer. Histologically, the EOE samples contained many cells in addition to ameloblasts, while the odontoblast samples contained mostly odontoblasts. We can only estimate the fraction of GAPDH mRNA that was contributed by ameloblasts in the EOE samples.
If we assume that ameloblasts contributed 20% of the GAPDH, and that, among the EOE cells, only ameloblasts expressed enamel proteins and proteinases, then we would estimate from our results that the ratios of amelogenin mRNA in secretory-stage ameloblasts relative to odontoblasts lining dentin under the secretory-stage enamel and maturation-stage enamel would be 320:1 and 20,480:1, respectively. It is expected that similar adjustments are needed to estimate enamelin and sheathlin mRNA levels in ameloblasts relative to odontoblasts.
This study demonstrates that mRNAs encoding all enamel proteins and proteinases are expressed by odontoblasts. Previously, we demonstrated that odontoblasts splice amelogenin differently than do ameloblasts, and we used this difference to demonstrate that our dissection technique did not allow odontoblasts to be contaminated with ameloblasts (Oida et al., 2002). In addition, we prepared another odontoblast sample from an erupted young first molar in the root-forming stage. The molar had finished enamel formation, and the ameloblasts disappeared from the tooth. In spite of the absence of ameloblasts, amelogenin (Oida et al., 2002), enamelin, sheathlin, enamelysin, and KLK4 PCR products were detected in this odontoblast sample (Fig. 2 ). The expression of amelogenins by odontoblasts explains the histochemical detection of amelogenin in the dentin matrix and odontoblastic processes, as was observed previously (Uchida et al., 1991). The function of amelogenin in the dentin matrix is unknown at present.
Enamelysin and KLK4 were expressed by both ameloblasts and odontoblasts. Enamelysin mRNA expression was 16-fold higher in secretory EOE relative to maturation EOE. For KLK4, this trend was reversed: KLK4 mRNA expression in maturation EOE was 32-fold higher than in secretory EOE. In contrast, changes in enamelysin and KLK4 mRNA levels in odontoblasts were fairly constant, both dropping about 25% in older odontoblasts relative to younger odontoblasts. Enamelysin mRNA levels in secretory EOE were about half those of the odontoblasts, suggesting that secretory ameloblasts specifically may express enamelysin mRNA at slightly higher levels than odontoblasts. KLK4 mRNA levels were twice as high in maturation EOE as in odontoblasts, suggesting that maturation ameloblasts specifically may express KLK4 mRNA at levels 10-fold higher than in odontoblasts. In contrast, KLK4 mRNA in secretory-stage EOE was much lower than in younger and older odontoblasts, indicating that KLK4 mRNA is expressed more in odontoblasts than in the secretory ameloblasts, even when one takes into account the number of cells other than ameloblasts in the secretory EOE sample.
We conclude from this study that, in the pig, secretory ameloblasts express mRNAs encoding enamel structural proteins at levels thousands of times higher than do maturation ameloblasts and odontoblasts lining dentin beneath maturing enamel, and hundreds of times higher than do odontoblasts lining dentin beneath secretory-stage enamel. Younger odontoblasts lining dentin closer to the EDJ express mRNAs encoding enamel structural proteins at levels over 30-fold higher than do older odontoblasts forming dentin further from the EDJ. These findings suggest that enamel structural proteins secreted by odontoblasts may play some part in the formation of dentin, particularly dentin forming at the EDJ. Enamelysin and KLK4 are expressed by both ameloblasts and odontoblasts. Recently, KLK4 activity was detected in the highly mineralized enamel at the EDJ during the secretory stage (Fukae et al., 2002), despite the fact that no KLK4 activity was observed in the inner-layer enamel (Fukae et al., 2001), pre-dentin, or dentin (Fukae et al., 2002). KLK4 activity in the deepest inner-layer enamel during the secretory stage is probably secreted through the odontoblast dental tubules at the EDJ, where it degrades organic matrix to be replaced by mineral.
 |
ACKNOWLEDGMENTS
|
|---|
We thank all the members of our labs, especially Dr. T. Tanabe, Dr. Y. Yamakoshi, and Dr. T. Iwata. This study was supported by a grant-in-aid (No. 12671818) for funding High Technology Research Centers from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.
Received for publication October 15, 2002.
Revision received July 9, 2003.
Accepted for publication September 12, 2003.
 |
REFERENCES
|
|---|
- Bartlett JD, Simmer JP, Xue J, Margolis HC, Moreno EC (1996). Molecular cloning and mRNA tissue distribution of a novel matrix metalloproteinase isolated from porcine enamel organ. Gene 183:123–128.[CrossRef][Medline]
[Order article via Infotrieve]
- Bègue-Kirn C, Krebsbach PH, Bartlett JD, Butler WT (1998). Dentin sialoprotein, dentin phoshoprotein, enamelysin and ameloblastin: tooth-specific molecules that are distinctively expressed during murine dental differentiation. Eur J Oral Sci 106:963–970.[CrossRef][Medline]
[Order article via Infotrieve]
- Caterina J, Shi J, Krakora S, Bartlett JD, Engler JA, Kozak CA, et al. (1999). Isolation, characterization, and chromosomal location of the mouse enamelysin gene. Genomics 62:308–311.[CrossRef][Medline]
[Order article via Infotrieve]
- Cerny R, Slaby I, Hammarström L, Wurz T (1996). A novel gene expressed in rat ameloblasts codes for proteins with cell binding domains. J Bone Miner Res 11:883–891.[Medline]
[Order article via Infotrieve]
- Fukae M, Tanabe T (1987). Nonamelogenin components of porcine enamel in the protein fraction free from the enamel crystals. Calcif Tissue Int 40:286–293.[Medline]
[Order article via Infotrieve]
- Fukae M, Tanabe T (1998). Degradation of enamel matrix proteins in porcine secretory enamel. Connect Tissue Res 39:123–129.[Medline]
[Order article via Infotrieve]
- Fukae M, Tanabe T, Shimizu M (1977). Proteolytic enzyme activity in porcine immature enamel. Tsurumi Shigaku 3:15–17.[Medline]
[Order article via Infotrieve]
- Fukae M, Tanabe T, Uchida T, Lee SK, Ryu OH, Murakami C, et al. (1998). Enamelysin (matrix metalloproteinase-20): localization in the developing tooth and effects of pH and calcium on amelogenin hydrolysis. J Dent Res 77:1580–1588.
- Fukae M, Tanabe T, Yamakoshi Y, Yamada M, Ujiie Y, Oida S (2001). Immunoblot detection and expression of enamel proteins at the apical portion of the forming root in porcine permanent incisor tooth germs. J Bone Miner Metab 19:236–243.[CrossRef][Medline]
[Order article via Infotrieve]
- Fukae M, Tanabe T, Nagano T, Ando H, Yamakoshi Y, Yamada M, et al. (2002). Odontoblasts enhance the maturation of enamel crystals by secreting EMSP 1 at the enamel-dentin junction. J Dent Res 81:668–672.
- Hu CC, Fukae M, Uchida T, Qian Q, Zhang CH, Ryu OH, et al. (1997a). Sheathlin: cloning, cDNA/polypeptide seqences, and immunolocalization of porcine enamel sheath proteins. J Dent Res 76:648–657.
- Hu CC, Fukae M, Uchida T, Qian Q, Zhang CH, Ryu OH, et al. (1997b). Cloning and characterization of porcine enamelin mRNAs. J Dent Res 76:1720–1729.
- Hu CC, Hart TC, Dupont BR, Chen JJ, Sun X, Qian Q, et al. (2000). Cloning human enamelin cDNA, chromosomal localization, and analysis of expression during tooth development. J Dent Res 79:912–919.
- Hu JC, Ryu OH, Chen JJ, Uchida T, Wakida K, Murakami C, et al. (2000). Localization of EMSP 1 expression during tooth formation and cloning of mouse cDNA. J Dent Res 79:70–76.
- Inage T, Shimokawa H, Wakao K, Sasaki S (1996). Gene expression and localization of amelogenin in the rat incisor. Adv Dent Res 10:201–207.[Abstract/Free Full Text]
- Krebsbach PH, Lee SK, Matsuki Y, Kozack CA, Yamada KM, Yamada Y (1996). Full-length sequence, localization, and chromosomal mapping of ameloblastin. A novel tooth-specific gene. J Biol Chem 271:4431–4435.[Abstract/Free Full Text]
- Oida S, Nagano T, Yamakoshi Y, Ando H, Yamada M, Fukae M (2002). Amelogenin gene expression in porcine odontoblasts. J Dent Res 81:103–108.
- Shimizu M, Fukae M (1983). Enamel proteins. In: Mechanisms of tooth enamel formation. Suga S, editor. Tokyo: Quintessence Publishing Co. Inc., pp. 125-141.
- Simmer JP, Fukae M, Tanabe T, Yamakoshi Y, Uchida T, Xue J, et al. (1998). Purification, characterization, and cloning of enamel matrix serine proteinase 1. J Dent Res 77:377–386.
- Termine JD, Belcourt AB, Christner PJ, Conn KM, Nylen MU (1980). Properties of dissociatively extracted fetal tooth matrix proteins. I. Principal molecular species in developing bovine enamel. J Biol Chem 20:9760–9768.
- Uchida T, Tanabe T, Fukae M, Shimizu M, Yamada M, Miake K, et al. (1991). Immunochemical and immunohistochemical studies, using antisera against porcine 25kDa amelogenin, 89kDa enamelin and the 13-17kDa nonamelogenins, on immature enamel of the pig and rat. Histochemistry 96:129–138.[CrossRef][Medline]
[Order article via Infotrieve]
- Uchida T, Fukae M, Tanabe T, Yamakoshi Y, Satoda T, Murakami C, et al. (1995). Immunochemical and immunocytochemical study of a 15kDa non-amelogenin and related proteins in the porcine immature enamel: proposal of a new group of enamel proteins sheath proteins. Biomed Res 16:131–140.
Journal of Dental Research, Vol. 82, No. 12,
982-986 (2003)
DOI: 10.1177/154405910308201209

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y Kabasawa, K Nagumo, Y Takeda, N Kawashima, N Okada, K Omura, A Yamaguchi, and K Katsube
Amelogenin positive cells scattered in the interstitial component of odontogenic fibromas
J. Clin. Pathol.,
July 1, 2008;
61(7):
851 - 855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Li, C. Suggs, J. T. Wright, Z.-a. Yuan, M. Aragon, H. Fong, D. Simmons, B. Daly, E. E. Golub, G. Harrison, et al.
Partial Rescue of the Amelogenin Null Dental Enamel Phenotype
J. Biol. Chem.,
May 30, 2008;
283(22):
15056 - 15062.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. H. Ravindranath, A. Devarajan, and T. Uchida
Spatiotemporal Expression of Ameloblastin Isoforms during Murine Tooth Development
J. Biol. Chem.,
December 14, 2007;
282(50):
36370 - 36376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Paine, W. Luo, H.-J. Wang, P. Bringas Jr., A. Y. W. Ngan, V. G. Miklus, D.-H. Zhu, M. MacDougall, S. N. White, and M. L. Snead
Dentin Sialoprotein and Dentin Phosphoprotein Overexpression during Amelogenesis
J. Biol. Chem.,
September 9, 2005;
280(36):
31991 - 31998.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. V. Obiezu, S. J.C. Shan, A. Soosaipillai, L.-Y. Luo, L. Grass, G. Sotiropoulou, C. D. Petraki, P. A. Papanastasiou, M. A. Levesque, and E. P. Diamandis
Human Kallikrein 4: Quantitative Study in Tissues and Evidence for Its Secretion into Biological Fluids
Clin. Chem.,
August 1, 2005;
51(8):
1432 - 1442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P S Hart, T C Hart, M D Michalec, O H Ryu, D Simmons, S Hong, and J T Wright
Mutation in kallikrein 4 causes autosomal recessive hypomaturation amelogenesis imperfecta
J. Med. Genet.,
July 1, 2004;
41(7):
545 - 549.
[Full Text]
[PDF]
|
 |
|
|
|