|
Sign In to gain access to subscriptions and/or personal tools.
|
Pro-inflammatory Cytokines Up-regulate MUC1 Gene Expression in Oral Epithelial Cells
X. Li1,
L. Wang1,
D.P. Nunes2,
R.F. Troxler1,3 and
G.D. Offner1,2,*
1 Departments of Periodontology and Oral Biology,
2 Medicine, and
3 Biochemistry, GI Section, X-510, 650 Albany Street, Boston University Medical Center, Boston, MA 02118, USA;
Correspondence: * corresponding author, goffner{at}bu.edu
 |
ABSTRACT
|
|---|
The membrane-bound mucin MUC1 is expressed ubiquitously on epithelial surfaces and is thought to provide protection from bacterial and chemical injury. The present study was undertaken to determine whether MUC1 was expressed in cultured oral epithelial cells and whether expression is modulated by pro-inflammatory mediators released as part of the host response to infection by oral pathogens. Northern and Western blotting experiments showed that KB cells express MUC1 mRNA and protein. When cells were treated with interleukins (IL-1β, IL-6), tumor necrosis factor-alpha (TNF- ), or interferon-gamma (IFN- ), or combinations of these, real-time PCR demonstrated that MUC1 mRNA increased 1.4- to 3.2-fold. Interestingly, a significant increase in levels of MUC1 protein was also observed. While no effect was observed when KB cells were incubated with LPS from Porphyromonas gingivalis, infection of KB monolayers with this oral pathogen caused a 2.85-fold increase in MUC1 transcript levels. These results suggest that increased MUC1 synthesis may be a key element in the host response to infection with oral pathogens.
Key Words: mucin gene expression real-time PCR
 |
INTRODUCTION
|
|---|
The secreted salivary mucins MG1 and MG2 have many important functions in the oral cavity. They aid in mastication, speech, and swallowing and are components of the non-immune oral host defense system. Recently, we have shown that all major human salivary glands and oral epithelial cells also express the membrane-bound mucin MUC1 (Offner and Troxler, 2000; Liu et al., 2002). MUC1 is ubiquitously expressed in epithelial cells lining the respiratory, reproductive, and gastrointestinal tracts. In malignant cells, aberrant expression of MUC1 leads to disruption of cell-cell and cell-matrix interactions, whereas in normal cells, this mucin is primarily involved in protection of epithelial surfaces (Gendler and Spicer, 1995; Hanisch and Muller, 2000; Gendler, 2001). Recent studies have suggested that the protective role of MUC1 may also include providing resistance to bacterial infection. Muc1-null mice are significantly more susceptible to chronic ocular and lower reproductive tract infections than are wild-type animals with an intact Muc1 gene (DeSouza et al., 1999; Kardon et al., 1999). The protective effects of MUC1 may be especially important in the oral cavity, where epithelial surfaces are constantly exposed to a variety of both pathogenic and commensal microbes.
There is increasing evidence that exposure of epithelial cells in the respiratory epithelium to bacteria or their secreted products leads to increased transcription of genes for the secreted mucins MUC2 and MUC5AC, thus enhancing the epithelial-protective barrier (Dohrman et al., 1998; Li et al., 1998a,b). These mucin genes, which are not expressed in oral tissues, are also up-regulated by pro-inflammatory mediators such as interleukin-1 beta and TNF alpha (Smirnova et al, 2000; Song et al., 2003). In the oral cavity, chronic infection by oral micro-organisms such as Porphyromonas gingivalis, Actinobacillus actinomycetemcomitans, and Candida albicans leads to the production of these mediators as well as IL-6 and IFN- (Kesavalu et al., 2002; Rouabhia et al., 2002). Pro-inflammatory cytokines have been shown to increase MUC1 expression in several epithelial and hematopoietic cell lines (Clark et al., 1994; Reddy et al., 2003), as well as in normal and malignant breast epithelial cells (Lagow and Carson, 2002). Taken together, these results suggested the possibility that up-regulation of MUC1 could be a component of the host response to bacterial infection in the oral cavity.
Nothing is known about the regulation of MUC1 expression in oral epithelial cells, and the present investigation used real-time PCR to quantify MUC1 transcript levels in KB cells in response to pro-inflammatory mediators, P. gingivalis and P. gingivalis-derived LPS.
 |
MATERIALS & METHODS
|
|---|
Cell Culture and Treatment
KB cells (Human Oral Epidermoid Carcinoma) were obtained from ATCC (Rockville, MD, USA) and maintained in Dulbeccos Modified Eagles medium (DMEM; GIBCO-BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco-BRL), penicillin (100 units/mL), and streptomycin (50 mg/mL) in 5% CO2 at 37°C. Prior to treatment with cytokines, cells were incubated in serum-free medium for 24 hrs. Triplicate wells were treated with IL-1β (20 ng/mL), IL-6 (40 ng/mL), IL-10 (20 ng/mL), TNF- (20 ng/mL), or INF- (10 ng/mL), alone and in combination, for 4–8 hrs. All cytokines were purchased from Peprotech (Rocky Hill, NJ, USA). P. gingivalis LPS was kindly provided by Dr. Salomon Amar (Boston University Goldman School of Dental Medicine) and was used at a concentration of 10 µg/mL. P. gingivalis strain 381 cells were obtained from Dr. Caroline Genco (Department of Medicine, Boston University Medical Center) and cultured as described previously (Nassar et al., 2002). KB monolayers were infected with P. gingivalis cells at a Multiplicity of Infection (MOI) = 100 for 4 hrs in an atmosphere of 5% CO2 at 37°C.
RNA Isolation and cDNA Synthesis
RNA was isolated from control and cytokine-treated KB cells with the use of Tripure reagent (Roche, Indianapolis, IN, USA). First-strand cDNA was synthesized in 20-µL reactions containing 5 µg RNA, 1 µL 10 mM dNTP (ProMega, Madison, WI, USA), 100 pmol random hexamer primers (Amersham, Chicago, IL, USA), 4 µL 5x first-strand buffer, 1 µL 0.1 M DTT, 0.5 µL RNAse inhibitor (ProMega), and 2 µL M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Reaction mixtures were incubated for 10 min at 25°C followed by incubation for 50 min at 37°C.
Northern Blot Analysis of MUC1 mRNA Expression
RNA from control and treated cells was electrophoresed on 1% agarose denaturing gels and transferred to nylon membranes (Hybond N+, Amersham) via capillary blotting for 16 hrs in 20 x SSC. Blots were hybridized overnight with a 32P-labeled 232-bp MUC1 tandem-repeat probe (Liu et al., 2002) at 42°C in 50% formamide, 5 x SSC, 10 x Denhardts solution, 2% SDS, 10% dextran sulfate, and 100 µg/mL of sheared salmon sperm DNA. Blots were washed twice in 2 x SSC, 0.1% SDS for 15 min at room temperature, followed by a final wash with 0.1 x SSC, 0.1% SDS at 65°C and were exposed to Kodak X-Omat film (Eastman Kodak, Rochester, NY, USA) at -80°C.
Cell Lysate Preparation and Western Blots
Cells underwent lysis on ice for 45 min on a rocker platform in RIPA lysis buffer [1 x PBS, 1% Nonidet P-40 (NP-40), 0.1% SDS, 0.5% sodium deoxycholate, and complete mini-protease inhibitor cocktail tablets (Roche)], and cell lysates were passed through a 21-gauge needle to shear DNA. After centrifugation at 10,000 x g for 10 min at 4°C, the soluble protein fraction was recovered and total protein concentration was determined by BCA protein assay (Pierce, Rockford, IL, USA). Cell lysates were examined by SDS-PAGE on 6% polyacrylamide gels or on Tricine gels (Schagger and von Jagow, 1987), and proteins were transferred to nitrocellulose membrane. Membranes were blocked for 1 hr at room temperature in 5% non-fat dry milk dissolved in phosphate-buffered saline (137 mM NaCl, 12 mM NaH2PO4, 2 mM KH2PO4, and 0.2 mM KCl) containing 0.05% Tween 20 (PBST) and incubated with MUC1-specific primary antibodies for 1 hr at room temperature. The MUC1-specific antibodies were mouse monoclonal antibody VU-4H5 (1:500 dilution; NeoMarkers, Fremont, CA, USA), which recognizes a peptide epitope in the MUC1 tandem repeat, and hamster monoclonal antibody CT2 (1:300 dilution; kindly provided by Dr. Sandra Gendler, Mayo Clinic, Scottsdale, AZ, USA), which recognizes the cytoplasmic tail. After being washed 4 times for 5 min with PBST, blots were incubated with HRP-conjugated species-specific secondary antibodies, and immunoreactive bands were visualized by enhanced chemiluminescence (Perkin Elmer, Boston, MA, USA).
Real-time PCR
We used real-time PCR to quantify levels of MUC1 mRNA in control and treated cells relative to levels of actin mRNA. The forward and reverse primers used to generate a 207-bp MUC1 amplicon were: 5' CGCCGAAAGAACTACGGGCAGCTG and 5' CAAGTTGGCAGAAGTGGCTGCCAC, respectively. The forward and reverse primers used to generate a 231-bp actin amplicon were: 5' GCGGGAAATCGTGCGTGACATT and 5' GATGGAGTTGAAGGTAGTTTCGTG, respectively. Primers were designed to span intron/exon boundaries to verify that PCR products are amplified from cDNA.
Real-time PCR was performed on a DNA Engine Opticon System (MJ Research, Waltham, MA, USA). All 25-µL reactions contained cDNA (1 µL), QuantiTect SYBR Green PCR Master Mix (Qiagen, Valencia, CA, USA) (12.5 µL), and specific primers (15 pmol). Reaction components were assembled in strip tubes with ultra-clear strip caps (MJ Research). The cycle profile was: 1 cycle at 95°C for 15 min followed by 40 cycles at 95°C for 30 sec; 55°C (for MUC1) or 50°C (for β-actin) for 30 sec; and at 72°C for 30 sec (for MUC1) or for 20 sec (for β-actin). Standard curves for MUC1 and β-actin were generated with the use of a serially diluted template of known copy number. To verify the specificity of the amplification reaction, we performed melting curve analysis by increasing the temperature from 55°C to 95°C at a temperature transition rate of 0.5°C/sec. In addition, reaction products were examined on agarose gels. We normalized data from triplicate reactions using the ratio of target MUC1 cDNA to that of β-actin.
Statistical Analysis
Data are expressed as mean ± SEM. Statistical significance was determined by the Wilcoxon signed-rank test. P values of less than 0.05 were considered statistically significant.
 |
RESULTS
|
|---|
Northern Blotting
To demonstrate expression of MUC1 mRNA in KB cells, we hybridized Northern blots with a cDNA probe containing MUC1 tandem repeats. Two discrete MUC1 transcripts of approximately 6.4 and 4.7 kb were observed (Fig. 1 , lane 1). This pattern of bands closely resembles that on blots of RNA from human parotid, submandibular, and sublingual glands (Liu et al., 2002). The 6.4-kb transcript likely represents the full-length MUC1 mRNA, while the 4.7-kb transcript may represent an allelic variant with fewer tandem repeats (Gendler et al., 1990).

View larger version (32K):
[in this window]
[in a new window]
|
Figure 1. Expression of MUC1 in KB oral epithelial cells. (Lane 1) Northern blot of RNA isolated from KB cells hybridized with a 32P-labeled MUC1 tandem-repeat probe. The positions of the 6.4- and 4.7-kb MUC1 transcripts are indicated with arrows. (Lanes 2, 3) Western blot of proteins in KB cell lysates probed with MUC1-specific antibodies. Blots were probed with monoclonal antibody VU-4H5 (1:500 dilution) to detect the extracellular subunit of MUC1 (lane 2) or with monoclonal antibody CT2 (1:300 dilution) to detect the cytoplasmic subunit of MUC1 (lane 3).
|
|
Western Blotting
To determine if MUC1 protein could be detected in KB cells, we subjected cell lysates to electrophoresis and probed Western blots with MUC1-specific antibodies. MUC1 is a heterodimeric mucin cleaved during synthesis to generate an extracellular subunit containing the tandem repeats and a smaller subunit comprised of a short extracellular region, a transmembrane-spanning domain, and a short cytoplasmic tail. These subunits are associated non-covalently at the cell surface and dissociate during electrophoresis. Lysates were subjected to electrophoresis on 6% polyacrylamide gels and blotted; blots were probed with MUC1 antibody VU-4H5 directed against extracellular tandem repeats. Two immunoreactive bands with molecular weights of ~ 180 kD and ~ 250 kD were observed (Fig. 1 , lane 2), perhaps indicating co-allelic expression of MUC1 (Treon et al., 1999). Blots of proteins in lysates subjected to electrophoresis on Tricine gels were probed with MUC1 antibody CT2 directed against the cytoplasmic tail. This antibody detected a series of immunoreactive bands with molecular weights ranging from 15 to 25 kDa which could represent different glycoforms or variously processed fragments (Fig. 1 , lane 3).
Cytokines and P. gingivalis Infection Modulate MUC1 Transcript Levels
KB cells were treated with pro-inflammatory mediators, RNA was isolated, and cDNA was synthesized and subjected to real-time PCR. Reactions were performed in the presence of SYBR Green with the use of MUC1 and β-actin gene-specific primers. To generate standard curves, we amplified serially diluted MUC1 and β-actin templates and plotted the log of the number of target molecules against Ct (threshold cycle). Regression analysis demonstrated R2 values of 0.999 and 1.00 for the MUC1 and β-actin standard curves, respectively (data not shown). Representative real-time PCR plots of transcript levels of MUC1 and β-actin in control and cytokine-treated cells show an increase in the fluorescent signal as a function of cycle number. Transcript levels in each sample were then quantified by reference to the standard curves, and MUC1 expression levels were normalized to levels of β-actin. Melting curves of PCR products obtained with both MUC1 and β-actin primers confirmed the presence of a single amplification product. When KB cells were treated for 4 hrs with IL-1β, IL-6, TNF- , or IFN- alone, MUC1 transcripts exhibited an increase of 1.4- to 2.1-fold. However, when KB cells were treated with combinations of mediators, particularly IL-1β/IFN- and TNF- /IFN- , MUC1 transcripts increased approximately three-fold compared with MUC1 transcripts in control cells (Fig. 2 ). No increase in MUC1 transcript levels was observed after treatment with the anti-inflammatory cytokine IL-10 or LPS from P. gingivalis. However, infection of KB monolayer cells with P. gingivalis cells for 4 hrs led to a 2.85-fold increase in MUC1 transcripts (Fig. 2 ).

View larger version (15K):
[in this window]
[in a new window]
|
Figure 2. Pro-inflammatory cytokines and oral bacteria up-regulate MUC1 mRNA expression. RNA was isolated from control cells and cells treated with cytokines, LPS, or P. gingivalis for 4 hrs and reverse-transcribed; the resulting cDNAs were amplified by real-time PCR with MUC1- and β-actin-specific primers. Transcript levels were calculated by reference to the standard curves, and MUC1 mRNA levels were normalized to those of β-actin. Each bar represents cDNA from 3 independent experiments analyzed in triplicate. The fold increase in transcript levels over untreated controls is expressed as mean ± SEM, and statistical significance (P < 0.05) is indicated with an asterisk.
|
|
Cytokines Modulate MUC1 Protein Levels
After treatment with combinations of pro-inflammatory mediators, soluble proteins in cell lysates were subjected to electrophoresis and blotted; blots were probed with anti-CT2 antibodies directed against the cytoplasmic tail of MUC1. Levels of MUC1 protein in cells incubated with IL-1β/IFN- , IL-6/TNF- , or TNF- /IFN- for 8 hrs were significantly higher than those in untreated control cells (Fig. 3 ). Treatment of cells with the same combinations of mediators for 4 hrs yielded nearly identical results (data not shown). Increased levels of MUC1 protein are consistent with increased MUC1 mRNA levels observed after treatment with the same combinations of mediators shown in Fig. 2 . These results show that cytokines promote transcription of the MUC1 gene, leading to high levels of stable MUC1 protein expression.

View larger version (34K):
[in this window]
[in a new window]
|
Figure 3. Pro-inflammatory cytokines up-regulate MUC1 protein expression. Lysates from control cells and cells treated with combinations of cytokines for 8 hrs were subjected to electrophoresis on Tris-tricine gels and blotted; the blots were probed with the MUC1 antibody CT2 as described in the legend to Fig. 1 .
|
|
 |
DISCUSSION
|
|---|
Mucins are key components of the physical barrier on epithelial surfaces that protects underlying cells and tissues from pathogenic microbes and other cytotoxic agents. In the oral cavity, mucins MUC5B (MG1) and MUC7 (MG2) are secreted by glandular acinar cells and minor salivary glands. While these mucins are important for lubricating epithelial surfaces, maintaining the rheological properties of saliva, and clearance of oral microbes, they are only transient components of saliva and are swallowed soon after secretion. The membrane-bound mucin MUC1 is synthesized in oral epithelial cells (Offner and Troxler, 2000; Liu et al., 2002) and remains on the cell surface after secretion. Thus, MUC1 may have a key role in protection of oral epithelial surfaces continuously exposed to a variety of chemical and microbial agents.
In the present investigation, we have shown that MUC1 expression is up-regulated by treatment of oral epithelial cells with the pro-inflammatory mediators IL-1β, IL-6, TNF- , and IFN- . Real-time PCR revealed that treatment with each of these cytokines alone caused an ca. two-fold increase in MUC1 mRNA levels, whereas treatment with combinations of mediators nearly doubled this effect. The additive effect of mediators suggests that MUC1 gene expression is up-regulated by one or more different signal transduction pathways. Interestingly, cytokine treatment resulted in even greater (ca. five- to 10-fold) increases in MUC1 protein levels, suggesting control at both the transcriptional and translational levels.
The effect of pro-inflammatory mediators on MUC1 RNA and protein expression observed in this study is important, since the same cytokines are produced in oral tissues in response to infection with the periodontal pathogens P. gingivalis (Sandros et al., 2000; Steffen et al., 2000; Imatani et al., 2001; Lourbakos et al., 2001) and A. actinomycetemcomitans (Sfakianakis et al., 2001; Uchida et al., 2001), the cariogenic dental pathogen S. mutans (Hahn et al., 2000), and the pathogenic yeast C. albicans (Rouabhia et al., 2002; Steele and Fidel, 2002). Both epithelial and non-epithelial cells appear to be capable of synthesizing pro-inflammatory cytokines in response to a microbial challenge (Sandros et al., 2000; Uchida et al., 2001; Gemmell et al., 2002). This indicates that increased MUC1 expression could be mediated by either autocrine or paracrine pathways and suggests a mechanism by which this mucin participates in oral host defense.
No effect on MUC1 expression was observed after treatment with either the anti-inflammatory cytokine IL-10 or P. gingivalis LPS, whereas a significant increase in MUC1 transcript levels was found after infection of KB cells with P. gingivalis cells for 4 hrs. KB cells, like gingival epithelial cells, express the toll-like receptors TLR2 and TLR4, but not CD14, which is a co-receptor for LPS (Uehara et al., 2001). Thus, while LPS is recognized as an important factor in the chronic inflammation associated with periodontal disease (Nonnenmacher et al., 2001; Wang and Ohura, 2002), its effect is primarily on monocytes and gingival fibroblasts. The present study shows that MUC1 expression can be stimulated either indirectly through the effects of inflammatory mediators or directly by bacterial binding or bacterial products other than LPS.
The relationship between mucins and bacteria is somewhat paradoxical. On the one hand, mucins protect epithelial surfaces from bacterial colonization, yet they may also serve as bacterial attachment sites (Lillehoj et al., 2001, 2002). A mechanism could be envisioned in which binding of bacteria to MUC1 on oral surfaces initiates a signaling cascade which leads to increased production of pro-inflammatory cytokines by the epithelial cells. Increased cytokine production could lead to up-regulation of MUC1 gene expression, resulting in increased numbers of mucin molecules on the cell surface. This would lead to strengthening of the protective barrier and diminished bacterial invasion. It is also possible that increased MUC1 density on the cell membrane could lead to enhanced shedding of the extracellular mucin subunit, together with adherent bacteria. Regulation of MUC1 expression could thus represent a novel mechanism for clearance of pathogenic organisms from the oral cavity.
 |
ACKNOWLEDGMENTS
|
|---|
This study was supported by NIH grants DE 14080 and DE 11691. The authors thank Dr. Sandra Gendler (Mayo Clinic, Scottsdale, AZ) for providing the CT2 antibody.
Received for publication March 25, 2003.
Revision received September 9, 2003.
Accepted for publication September 10, 2003.
 |
REFERENCES
|
|---|
- Clark S, McGuckin MA, Hurst T, Ward BG (1994). Effect of interferon-gamma and TNF-alpha on MUC1 mucin expression in ovarian carcinoma cell lines. Dis Markers 12:43–50.[Medline]
[Order article via Infotrieve]
- DeSouza MM, Surveyor GA, Price RE, Julian J, Kardon R, Zhou X, et al. (1999). MUC1/episialin: a critical barrier in the female reproductive tract. J Reprod Immunol 45:127–158.[Medline]
[Order article via Infotrieve]
- Dohrman A, Miyata S, Gallup M, Li JD, Chapelin C, Coste A, et al. (1998). Mucin gene MUC 2 and MUC 5AC) upregulation by Gram-positive and Gram-negative bacteria. Biochim Biophys Acta 1406:251–259.[Medline]
[Order article via Infotrieve]
- Gemmell E, Carter CL, Grieco DA, Sugerman PB, Seymour GJ (2002). P. gingivalis-specific T-cell lines produce Th1 and Th2 cytokines. J Dent Res 81:303–307.
- Gendler SJ (2001). MUC1, the renaissance molecule. J Mammary Gland Neoplasia 6:339–353.
- Gendler SJ, Spicer AP (1995). Epithelial mucin genes. Annu Rev Physiol 57:607–634.[CrossRef][Medline]
[Order article via Infotrieve]
- Gendler SJ, Lancaster CA, Taylor-Papadimitriou J, Duhig T, Peat N, Burchell J, et al. (1990). Molecular cloning and expression of human tumor-associated polymorphic epithelial mucin. J Biol Chem 265:15286–15293.[Abstract/Free Full Text]
- Hahn CL, Best AM, Tew JG (2000). Cytokine induction by Streptococcus mutans and pulpal pathogenesis. Infect Immun 68:6785–6789.[Abstract/Free Full Text]
- Hanisch FG, Muller S (2000). MUC1: the polymorphic appearance of a human mucin. Glycobiology 10:439–449.[Free Full Text]
- Imatani T, Kato T, Okuda K (2001). Production of inflammatory cytokines by human gingival fibroblasts stimulated by cell-surface preparations of Porphyromonas gingivalis. Oral Microbiol Immunol 16:65–72.[CrossRef][Medline]
[Order article via Infotrieve]
- Kardon R, Price RE, Julian J, Lagow E, Tseng SC, Gendler SJ, et al. (1999). Bacterial conjunctivitis in MUC1 null mice. Invest Ophthalmol Vis Sci 40:1328–1335.[Abstract/Free Full Text]
- Kesavalu L, Chandrasekar B, Ebersole JL (2002). In vivo induction of proinflammatory cytokines in mouse tissue by Porphyromonas gingivalis and Actinobacillus actinomycetemcomitans. Oral Microbiol Immunol 17:177–180.[CrossRef][Medline]
[Order article via Infotrieve]
- Lagow EL, Carson DD (2002). Synergistic stimulation of MUC1 expression in normal breast epithelia and breast cancer cells by interferon-gamma and tumor necrosis factor-alpha. J Cell Biochem 86:759–772.[CrossRef][Medline]
[Order article via Infotrieve]
- Li D, Gallup M, Fan N, Szymkowski DE, Basbaum CB (1998a). Cloning of the amino-terminal and 5'-flanking region of the human MUC5AC mucin gene and transcriptional up-regulation by bacterial exoproducts. J Biol Chem 273:6812–6820.[Abstract/Free Full Text]
- Li JD, Feng W, Gallup M, Kim JH, Gum J, Kim Y, et al. (1998b). Activation of NF-kappaB via a Src-dependent Ras-MAPK-pp90rsk pathway is required for Pseudomonas aeruginosa-induced mucin overproduction in epithelial cells. Proc Natl Acad Sci USA 95:5718–5723.[Abstract/Free Full Text]
- Lillehoj EP, Hyun SW, Kim BT, Zhang XG, Lee DI, Rowland S, et al. (2001). Muc1 mucins on the cell surface are adhesion sites for Pseudomonas aeruginosa. Am J Physiol Lung Cell Mol Physiol 280:L181–L187.[Abstract/Free Full Text]
- Lillehoj EP, Kim BT, Kim KC (2002). Identification of Pseudomonas aeruginosa flagellin as an adhesin for Muc1 mucin. Am J Physiol Lung Cell Mol Physiol 282:L751–L756.[Abstract/Free Full Text]
- Liu B, Lague JR, Nunes DP, Toselli P, Oppenheim FG, Soares RV, et al. (2002). Expression of membrane-associated mucins MUC1 and MUC4 in major human salivary glands. J Histochem Cytochem 50:811–820.[Abstract/Free Full Text]
- Lourbakos A, Potempa J, Travis J, DAndrea MR, Andrade-Gordon P, Santulli R, et al. (2001). Arginine-specific protease from Porphyromonas gingivalis activates protease-activated receptors on human oral epithelial cells and induces interleukin-6 secretion. Infect Immun 69:5121–5130.[Abstract/Free Full Text]
- Nassar H, Chou HH, Khlgatian M, Gibson FC 3rd, Van Dyke TE, Genco CA (2002). Role for fimbriae and lysine-specific cysteine proteinase gingipain K in expression of interleukin-8 and monocyte chemoattractant protein in Porphyromonas gingivalis-infected endothelial cells. Infect Immun 70:268–276.[Abstract/Free Full Text]
- Nonnenmacher C, Mutters R, de Jacoby LF (2001). Microbiological characteristics of subgingival microbiota in adult periodontitis, localized juvenile periodontitis and rapidly progressive periodontitis subjects. Clin Microbiol Infect 7:213–217.[CrossRef][Medline]
[Order article via Infotrieve]
- Offner GD, Troxler RF (2000). Heterogeneity of high-molecular-weight human salivary mucins. Adv Dent Res 14:69–75.[Abstract/Free Full Text]
- Reddy PK, Gold DV, Cardillo TM, Goldenberg DM, Li H, Burton JD (2003). Interferon-gamma upregulates MUC1 expression in haematopoietic and epithelial cancer cell lines, an effect associated with MUC1 mRNA induction. Eur J Cancer 39:397–404.[Medline]
[Order article via Infotrieve]
- Rouabhia M, Ross G, Page N, Chakir J (2002). Interleukin-18 and gamma interferon production by oral epithelial cells in response to exposure to Candida albicans or lipopolysaccharide stimulation. Infect Immun 70:7073–7080.[Abstract/Free Full Text]
- Sandros J, Karlsson C, Lappin DF, Madianos PN, Kinane DF, Papapanou PN (2000). Cytokine responses of oral epithelial cells to Porphyromonas gingivalis infection. J Dent Res 79:1808–1814.
- Schagger H, von Jagow G (1987). Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal Biochem 166:368–379.[CrossRef][Medline]
[Order article via Infotrieve]
- Sfakianakis A, Barr CE, Kreutzer DL (2001). Actinobacillus actinomycetemcomitans-induced expression of IL-1alpha and IL-1beta in human gingival epithelial cells: role in IL-8 expression. Eur J Oral Sci 109:393–401.[CrossRef][Medline]
[Order article via Infotrieve]
- Smirnova MG, Birchall JP, Pearson JP (2000). TNF-alpha in the regulation of MUC5AC secretion: some aspects of cytokine-induced mucin hypersecretion on the in vitro model. Cytokine 12:1732–1736.[CrossRef][Medline]
[Order article via Infotrieve]
- Song KS, Lee WJ, Chung KC, Koo JS, Yang EJ, Choi JY, et al. (2003). Interleukin-1 beta and tumor necrosis factor alpha induce MUC5AC overexpression through a mechanism involving ERK/p38 mitogen-activated protein kinases-MSK-1CREB activation in human airway epithelial cells. J Biol Chem 278:23243–23250.[Abstract/Free Full Text]
- Steele C, Fidel PL Jr (2002). Cytokine and chemokine production by human oral and vaginal epithelial cells in response to Candida albicans. Infect Immun 70:577–583.[Abstract/Free Full Text]
- Steffen MJ, Holt SC, Ebersole JL (2000). Porphyromonas gingivalis induction of mediator and cytokine secretion by human gingival fibroblasts. Oral Microbiol Immunol 15:172–180.[CrossRef][Medline]
[Order article via Infotrieve]
- Treon SP, Mollick JA, Urashima M, Teoh G, Chauhan D, Ogata A, et al. (1999). Muc-1 core protein is expressed on multiple myeloma cells and is induced by dexamethasone. Blood 93:1287–1298.[Abstract/Free Full Text]
- Uchida Y, Shiba H, Komatsuzawa H, Takemoto T, Sakata M, Fujita T, et al. (2001). Expression of IL-1 beta and IL-8 by human gingival epithelial cells in response to Actinobacillus actinomycetemcomitans. Cytokine 14:152–161.[CrossRef][Medline]
[Order article via Infotrieve]
- Uehara A, Sugawara S, Tamai R, Takada H (2001). Contrasting responses of human gingival and colonic epithelial cells to lipopolysaccharides, lipoteichoic acids and peptidoglycans in the presence of soluble CD14. Med Microbiol Immunol 189:185–192.[CrossRef][Medline]
[Order article via Infotrieve]
- Wang PL, Ohura K (2002). Porphyromonas gingivalis lipopolysaccharide signaling in gingival fibroblasts—CD14 and toll-like receptors. Crit Rev Oral Biol Med 13:132–142.[Abstract/Free Full Text]
Journal of Dental Research, Vol. 82, No. 11,
883-887 (2003)
DOI: 10.1177/154405910308201107

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati Twitter What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. A. Budiu, I. Diaconu, R. Chrissluis, A. Dricu, R. P. Edwards, and A. M. Vlad
A conditional mouse model for human MUC1-positive endometriosis shows the presence of anti-MUC1 antibodies and Foxp3+ regulatory T cells
Dis. Model. Mech.,
November 1, 2009;
2(11-12):
593 - 603.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Lievin-Le Moal and A. L. Servin
The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota
Clin. Microbiol. Rev.,
April 1, 2006;
19(2):
315 - 337.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|