| Sign In to gain access to subscriptions and/or personal tools. |
Activation of Vanilloid Receptor 1 (VR1) by EugenolDepartment of Physiology, College of Dentistry and Dental Research Institute, Seoul National University, 28-2 Yeongeon-Dong ChongNo-Ku, Seoul, Korea 110-749; Correspondence: #corresponding author, odolbae{at}snu.ac.kr
The structural similarity of eugenol with capsaicin suggests that these two agents may share molecular mechanisms to produce their effects. We investigated the effects of eugenol in comparison with those of capsaicin using whole-cell patch clamp and Fura-2-based calcium-imaging techniques in a heterologous expression system and with sensory neurons. In vanilloid receptor 1 (VR1)-expressing human embryonic kidney (HEK) 293 cells and trigeminal ganglion (TG) neurons, eugenol activated inward currents, whereas capsazepine, a competitive VR antagonist, and ruthenium red (RR), a functional VR antagonist, completely blocked eugenol-induced inward currents. Moreover, eugenol caused elevation of [Ca2+]i, and this was completely abolished by both capsazepine and ruthenium red in VR1-expressing HEK 293 cells and TG neurons. Our results provide strong evidence that eugenol produces its effects, at least in part, via VR1 expressed by the sensory nerve endings in the teeth.
Key Words: eugenol • capsaicin • trigeminal ganglion • HEK 293 cells • vanilloid receptor 1
Eugenol, the major component of essential oil of cloves, has been used in dental practice to relieve pain arising from a variety of sources, including pulpitis and dentinal hypersensitivity (Sneddon and Glew, 1973). Interestingly, eugenol exhibits irritant action in addition to its analgesic effect (Sneddon and Glew, 1973), which is reminiscent of the effects of capsaicin (Holzer, 1991; Szallasi and Blumberg, 1999). However, the molecular mechanisms underlying these eugenol actions are not completely understood. Natural pungent substances such as piperine, zingerine, and capsaicin conserve a common chemical structure, a vanillyl-like moiety, which is believed to be essential for their capsaicin-like activity (Sterner and Szallasi, 1999; Szallasi and Blumberg, 1999). The fact that eugenol, as a natural capsaicin congener, also contains vanillyl-moiety-like capsaicin (Szallasi and Blumberg, 1999) suggests that eugenol may act on vanilloid receptor 1 (VR1) as capsaicin does in sensory neurons (Caterina et al., 1997; Helliwell et al., 1998; Tominaga et al., 1998). Indeed, Patacchini et al.(1990) reported that eugenol has capsaicin-like activity on the visceral primary afferents in the rat urinary bladder. Recently, it has been demonstrated that eugenol acts on a Ca-permeable channels (probably a VR) (Ohkubo and Kitamura, 1997), and capsazepine abolishes the antinociceptive effects of eugenol (Ohkubo and Shibata, 1997). In the present study, to elucidate the molecular mechanisms underlying pharmacological actions of eugenol in comparison with those of capsaicin, we investigated if eugenol activates VR1 in a heterologous expression system and rat trigeminal ganglion (TG) neurons.
VR1 Receptor Cloning and Preparation of Expression Constructs All procedures involving animals were reviewed and approved by the Animal Care and Use Committee of the Seoul National University prior to the experiments. Total RNA was prepared from neonatal Holzmann rat dorsal root ganglion (DRG) neurons by means of Trizol reagent (Life Technologies, Gaithersburg, MD, USA) according to the manufacturer’s instructions. cDNA was prepared from 5 µg of total RNA with SuperScript II reverse transcriptase (Life Technologies) according to the manufacturer’s instructions, and was primed with oligo dT oligonucleotide. The rat VR1 was amplified from 2 µL of rat DRG cDNA with the use of Taq DNA polymerase (Life Technologies) and two sets of forward/reverse primers, "GCCACAGAGGATCTGGAAAG(F1)/ CGGTGACTCGGAAATAGTCC(R1)" and "TGACATGCTTCTCGTGG AAC(F2)/GCACAGAGTGGACCCAGATAA(R2)". The two PCR products (P1/P2) were gel-purified and cloned with the use of the TOPO TA cloning kit (Invitrogen, Carlsbad, CA USA), respectively. The resulting clones were sequenced by automated DNA sequencing. The SacII/XbaI fragment of P1 and the SacII/NotI fragment of P2 were ligated into pcDNA3.1 digested with XbaI and NotI. The resulting clones were verified by restriction analysis and DNA sequencing.
Cell Preparation and Transfection
Electrophysiologic Recordings
Intracellular Ca Imaging
Drugs
Eugenol Activated Inward Currents in VR1-expressing HEK 293 Cells. Recent studies (Ohkubo and Kitamura, 1997; Ohkubo and Shibata, 1997) suggested that eugenol might produce its effects via VR1. To confirm this possibility, we examined if eugenol would activate VR1 in a heterologous system—HEK 293 cells transiently transfected with VR1. Whereas eugenol did not produce any effects in intact HEK 293 cells that were not transfected with VR1 (data not shown), eugenol (1 mM) elicited inward currents in VR1-expressing HEK 293 cells (n = 10) (Fig. 1A  ). However, although the concentration of eugenol (1 mM) was 1000-fold higher than that of capsaicin (1 µM), eugenol-induced currents were slowly activated and significantly smaller in amplitude (Fig. 1A). The eugenol-activated currents were completely blocked by ruthenium red (RR, 10 µM)—a non-competitive VR antagonist (n = 3)—and capsazepine (CZP, 10 µM)—a competitive VR antagonist (n = 5) (Fig. 1B).
Eugenol Increased [Ca2+]i in VR1-expressing HEK 293 Cells If eugenol elicits inward currents through VR1, eugenol should increase [Ca2+]i as capsaicin does in the heterologous system (Caterina et al., 1997). Therefore, we tested this using Fura-2-based Ca imaging experiments in VR1-expressing HEK 293 cells. The application of either vehicle or eugenol in intact HEK 293 cells did not alter [Ca2+]i (n = 6) (data not shown). However, eugenol (1 mM) increased [Ca2+]i in VR1-expressing HEK 293 cells (n = 6) (Fig. 2A ). Moreover, the elevation of [Ca2+]i by eugenol was completely abolished by capsazepine (10 µM) (n = 5) (Fig. 2B) and RR (10 µM) (n = 4) (Fig. 2C).
Activation of VR1 by Eugenol in TG Neurons We also examined the effects of eugenol in TG neurons. In agreement with the results in a heterologous system (Fig. 1  ) and the effects of capsaicin in TG neurons (Liu and Simon, 1996a,b), eugenol elicited inward currents (Fig. 3A). In addition, RR (10 µM) (n = 3) and capsazepine (10 µM) (n = 3) blocked eugenol-induced inward currents (Figs. 3B, 3C).
We next tested if eugenol would increase [Ca2+]i in TG neurons. As shown in Fig. 4A , eugenol (1 mM) increased [Ca2+]i in the subpopulations of capsaicin-responsive TG neurons (n = 12/45). The elevation of [Ca2+]i by eugenol was completely abolished by capsazepine (10 µM) (n = 5) (Fig. 4B) and RR (10 µM) (n = 7) (Fig. 4C). In line with these findings, the eugenol-responsive neurons also showed elevated [Ca2+]i when treated with capsaicin (Figs. 4A, 4B), and Ca transients by capsaicin were completely blocked by both capsazepine (10 µM) (n = 5) (Fig. 4B) and RR (10 µM) (n = 7) (Fig. 4C). The viability of neurons was verified by their responses to 50 mM K+ (data not shown).
Biphasic (that is, initial pungent and delayed analgesic) pharmacological actions and common chemical structure shared by both capsaicin and eugenol raise the possibility that two molecules act on the same receptor—VR1. To confirm this hypothesis, we compared the effects of eugenol and capsaicin using whole-cell patch-clamp and Fura-2-based Ca imaging studies in VR1-expressing HEK 293 cells and rat TG neurons. From these studies, we found that: (1) eugenol elicited inward currents, (2) eugenol increased [Ca2+]i, (3) these effects produced by eugenol were readily prevented by the capsaicin receptor antagonists capsazepine and ruthenium red, and (4) reponses to eugenol were observed only in subpopulations of TG neurons which are responsive to capsaicin as well. These findings imply the involvement of VR1 in eugenol actions.
The VR1, which belongs to the TRP family of channels, is a non-selective cation channel, exhibiting a preference for divalent cations such as Ca (Caterina et al., 1997), and is primarily found on polymodal nociceptors (Helliwell et al., 1998; Caterina and Julius, 2001). Multiple VRs might exist, since the activation of VR receptors on TG neurons by capsaicin induced multiple inward currents with different peak amplitudes and durations (Liu and Simon, 1996a,b; Petersen et al., 1996). This phenomenon explains the initial stimulatory effect of capsaicin on polymodal nociceptors. We found that eugenol clearly evoked inward currents, although the currents exhibited slower activation and smaller amplitude than those of capsaicin. In addition, eugenol-induced Ca transients were observed only in subpopulations ( Capsazepine completely blocked eugenol-induced inward currents and Ca transients in VR1-expressing HEK cells and TG neurons. Although capsazepine is shown to produce non-specific effects with longer than 2 min application (Docherty et al., 1997; Liu and Simon, 1997), our results are unlikely to be due to its non-specific effects, since capsazepine was treated for only 1.5 min, and its effects were readily reversible in our experiment. Ruthenium red also blocked eugenol-induced currents and Ca transients. The dose of RR (10 µM) used in our experiments was within the range that is considered specific for VRs (0.1 to 10 µM) (Amann and Maggi, 1991). Thus, analysis of our data provides strong evidence that eugenol targeted VR1. In summary, analysis of our data demonstrates that eugenol may produce capsaicin-like effects through VR1, although its precise mechanism is not yet completely understood. Thus, the activation of VR1 expressed by the sensory nerve terminals in the teeth (Chaudhary et al., 2001) might be, at least in part, the molecular basis for the actions of eugenol.
We thank Dongjun Ren, Northwestern University, for technical support in making the VR1 construct. This work was supported by a Grant-in-aid for scientific research from the Ministry of Health and Welfare, Republic of Korea, 00-PJ1-PG1-CH11-0004.
* these authors contributed equally to this work;  Received for publication January 13, 2003. Revision received May 26, 2003. Accepted for publication July 23, 2003.
Journal of Dental Research, Vol. 82, No. 10,
781-785 (2003) This article has been cited by other articles:
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
|
|
 |
|
Sign In to gain access to subscriptions and/or personal tools.
TOP
ABSTRACT
INTRODUCTION
. The pipette solution was composed of (mM): CsCl 135, MgCl2 5, HEPES 12, Mg-ATP 5, EGTA 5, glucose 20, adjusted pH to 7.4 with CsOH. The bath was continuously perfused with extracellular solution containing (mM): NaCl 140, KCl 5, CaCl2 2, MgCl2 1, HEPES 5, glucose 20, adjusted to pH 7.4 with NaOH. Partial series resistance compensation was used, and currents were low-pass-filtered at 2 kHz and sampled at 10 kHz. pClamp6 (Axon Instruments) software was used during the experiments and analysis. 
30%) of capsaicin-responsive cells. Therefore, it is likely that eugenol activates VR1 with much less potency than capsaicin. Recently, it has been demonstrated that icilin, a cooling agent and potent activator of TRPM8, exhibited a response pattern in ANKTM1-expressing cells (
