Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

CiteULike is a free service for managing and discovering scholarly references - click here to get started.

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Arquitt, C.K.
Right arrow Articles by Wright, J.T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arquitt, C.K.
Right arrow Articles by Wright, J.T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*IRON
*POTASSIUM
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Cystic Fibrosis Transmembrane Regulator Gene (CFTR) is Associated with Abnormal Enamel Formation

C.K. Arquitt1, C. Boyd2 and J.T. Wright2,*

1 Private Practice, Pediatric Dentistry, Nashville, TN; and
2 Department of Pediatric Dentistry, School of Dentistry, Brauer Hall CB #7450, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7450;

Correspondence: * corresponding author, tim_wright{at}dentistry.unc.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cystic fibrosis (CF), a chloride ion transport disorder, is caused by mutations of the cftr gene and is the most common autosomal-recessive heritable disease in Caucasians. CFTR knockout mice have enamel with crystallite defects, retained protein, and hypomineralization, suggesting a role for CFTR in enamel formation and mineralization. This investigation examined CFTR expression and elemental composition in developing murine incisor teeth. RT-PCR showed cftr mRNA expression in the normal mouse apical incisor tissue but not in the CFTR knockout tissue. Elemental analysis by energy-dispersive x-ray spectroscopy showed relatively decreased chloride in secretory-stage CF enamel. Iron and potassium were significantly increased, and calcium was significantly decreased (p value = 0.05) in the CF mature enamel. Abnormal enamel mineralization, ion concentrations, and molecular evidence of cftr mRNA expression by odontogenic cells strongly suggest that CFTR plays an important role in enamel formation.

Key Words: amelogenesis • enamel • cystic fibrosis • ion • chloride • bicarbonate


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cystic Fibrosis (CF), the most common lethal autosomal-recessive disease in the Caucasian population (Collins, 1992), is characterized by abnormal electrolyte concentrations in exocrine secretions and failure to clear mucous secretions, resulting in obstruction and bacterial accumulation in the digestive, respiratory, and reproductive tracts and abnormal sweat chloride levels (Boat et al., 1989). Cystic fibrosis results from mutation of the cystic fibrosis transmembrane regulator protein gene (CFTR), a 1480-amino-acid cyclic AMP regulated chloride channel that helps regulate salt and water excretion in exocrine cells (Collins, 1992).

Historically, individuals with CF had a high prevalence of tooth discoloration (24%) and enamel hypoplasia (25% of patients with staining) associated with tetracycline therapy for frequent respiratory tract infections (Primosch, 1980). Enamel defects associated with tetracycline therapy have decreased, since alternative antibiotic regimens are now available. Other studies report variable enamel hypoplasia in CF patients ranging from 5% to 44% of CF individuals having enamel defects (Cooley, 1970; Jagels and Sweeney, 1976). Normal enamel has relatively high levels of carbonate, calcium, and phosphorus and numerous trace elements, including sodium, chloride, magnesium, potassium, sulfur, and zinc, that range in concentration from 100 to over 1000 ppm (Curzon and Cutress, 1983). Mineral analysis of the mature enamel of CF human teeth indicates that children with CF had equivalent levels of zinc (Cua, 1991a) and phosphorus and decreased calcium levels (Cua, 1991b) when compared with healthy control subjects, regardless of their tetracycline history.

A CFTR knockout mouse (CF mouse) was developed to study the early effects of CF by targeted gene disruption of exon 10 in the mouse cftr gene (Snouwaert et al., 1992). All CF homozygous mice have an abnormal enamel appearance not seen in their CF heterozygous littermates. Normal mature mouse enamel is hard, with a yellow-brown hue attributable to incorporation of iron during the maturation stage. In contrast, homozygous CF mouse enamel is white, with a soft consistency that fractures at the incisal edge. Preliminary analysis of the CF mouse enamel showed it to be hypomineralized, with increased protein and abnormalities of the crystallite structure (Wright et al., 1996a,b). Abnormal maturation-stage ameloblast morphology and retention of amelogenin in the mature CF enamel suggest an abnormality during the maturation process of enamel formation. Analysis of CF mouse incisors and molars shows that the defect is limited to the rapidly developing and continuously erupting incisor, with the molars being normal (Gawenis et al., 2001). Based on these observations, we hypothesize that the cftr gene is expressed in the murine incisor enamel organ and is responsible for the differences observed between the normal and CF mouse enamel. The specific aims of this investigation were to analyze the elemental composition in normal and CF mouse enamel and determine whether CFTR is expressed in developing murine incisors.


    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
All animals were handled in accordance with an IACUC-approved protocol.

Sample
The mice used for this investigation were homozygous (CF) and heterozygous (control) knockout mice for the murine equivalent to the human cftr gene. The mice consumed, ad libitum, GoLytely® (Braintree Laboratories Inc., Braintree, MA, USA), a liquid high in electrolytes and with 1 ppm fluoride, and were fed PicoLab® Mouse Diet 20 (Purina Co., St. Louis, MO, USA). Mice used for tissue dissection were killed with CO2 in strict accordance with IACUC and the University of North Carolina regulations and guidelines.

Elemental Analysis
The maxillary and mandibular teeth were extracted in 2 heterozygous and 2 homozygous female seven-month-old littermates immediately after death. The incisors were gently cleaned with de-ionized water and dried for 1 wk. The teeth were mounted on carbon stubs and carbon-coated by means of a rotary evaporation carbon coater. The enamel of the apical and incisal ends was analyzed by energy-dispersive x-ray spectroscopy with a Kevex Sigma III x-ray collector (Thermo Noran, Middleton, WI, USA) and microanalysis software in a JEOL 6300 scanning electron microscope (JEOL USA, Peabody, MA, USA) (SEM) for proportional mineral relationships of calcium, phosphorus, sodium, chloride, potassium, iron, and sulfur. Each sample was oriented similarly to the x-ray collector, by means of a notch placed 1 mm from the incisal edge and the apex, so that similar developmental stages could be located in each sample. All spectra were collected at the same magnification and operating conditions (i.e., kV and working distance).

Statistical analysis of the data was performed on the results from 8 CF and 7 control incisors by Student's t test with a significance level set at 0.05.

Reverse-transcriptase/Polymerase Chain-reaction (RT-PCR)
Odontogenic cells (apical progenitor enamel and pulp cells) were obtained from wild-type and homozygous CFTR knockout mice for evaluation of the expression of cftr mRNA by RT-PCR. The maxillary and mandibular incisors were extracted immediately after death, and the odontogenic cells at the apical tips were removed by means of a #11 scalpel blade. Apical tooth ends and small intestine (positive control) were immediately frozen in liquid nitrogen and stored at –80°C. Total RNA extraction for all samples was completed with the use of a Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer's instructions.

We used the mouse cystic fibrosis transmembrane conductance regulator mRNA for exons 9 through 12 to develop the cftr upstream and downstream primers used for RT-PCR. The mouse cftr amplified product was 375 base pairs long (Kelley et al., 1992). Intron spanning primers were designed to amplify cftr mRNA while reducing the likelihood of amplifying genomic cDNA. The downstream primer sequence was 5'GGATTTGGGGAATTACTGGAG3', and the upstream primer was 3'CTGCTGTAGTTGGCAAGCTTT5'.

RT-PCR of the CF and control mouse small intestine and odontogenic RNA was accomplished with the use of a Gene Amp reverse-transcriptase RNA PCR kit from Perkin Elmer. The RNA was incubated with a kit master mix and the downstream primer at 55° for 5 min in a Thermolyne Amplitron I®. rTth DNA polymerase was added at 70°C for 10 min. De-ionized water, 10x chelating buffer, 25 mmol/L MgCl2, and the upstream primer for CFTR were cycled with the reverse-transcribed cDNA for 40 cycles at 95°C for 1 min, 55°C for 1 min, and 70°C for 1 min in a Thermolyne Amplitron I®. A 10-µL quantity of each amplified sample and molecular-weight standards were combined with 3 µL of blue loading dye and run on a 1% agarose gel with ethydium bromide.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Elemental Analysis
One control mouse's maxillary right incisor was not included in the analysis due to fracture during extraction. Imaging of the area to be analyzed by Energy Dispersive X-Ray Spectroscopy (EDS) revealed a smooth and clean enamel surface that was devoid of cellular debris or contaminants. Elemental analysis of the secretory enamel showed similar distributions and quantities of elements between the CF and wild-type mice (TableGo). Statistical analysis indicated that there was significantly less chlorine in the secretory CF enamel compared with normal secretory enamel. All other minerals and the calcium-to-phosphorus ratio were not statistically different. The calcium:phosphorus ratio of 1.99 is consistent with the major mineral component in secretory enamel being hydroxyapatite. In contrast, elemental analysis of the mature CF and wild-type enamel showed several compositional differences (TableGo). The calcium and the calcium-to-phosphorus ratio were significantly decreased in the mature CF mouse enamel compared with the wild-type enamel. The relative iron and potassium levels were significantly increased in the mature CF enamel compared with the mature control enamel. The phosphorus, sodium, chlorine, and sulfur levels were similar in the mature CF and wild-type enamel.


View this table:
[in this window]
[in a new window]

 
Table. Elemental Composition of CF and Wild-type Mouse Secretory- and Maturation-stage Incisor Enamel
 
RT-PCR
RT-PCR showed that cftr mRNA was present in both the normal mouse intestine and apical tooth bud (Fig.Go). The appropriate molecular-weight amplified PCR product (375 bp) was visualized on the gel. As expected, there was no visible amplification product for the CF mouse intestine or apical tooth ends. Purification of the amplified PCR product and sequencing verified accurate amplification of the cftr mRNA.


Figure F
View larger version (61K):
[in this window]
[in a new window]

 
Figure. Amplification of CFTR RNA was seen in the wild-type mouse intestine (Co-I) and tooth bud (Co-T) but was not observed in the matched CF mouse tissues (CF-I = intestine; CF-T = tooth bud).

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study indicates that enamel in the murine CF mouse incisor develops abnormally, with altered cftr gene expression in odontogenic cells as the likely etiology. Disruption of cftr expression is associated with alteration of both the composition and the structure of incisor enamel. Murine odontogenic cells express the murine equivalent to the human cftr gene, as determined by reverse-transcriptase/polymerase chain-reaction. CFTR is known to be important in ion regulation, and there is evidence of altered ion permeability in the CF mouse's respiratory and intestinal epithelium (Grubb and Boucher, 1999). Strict regulation of ion concentrations is clearly important in odontogenic cells during development of the dental mineralized tissues, and altered ion permeability or transport in cells due to abnormal CFTR could result in the abnormal enamel formation seen in CF mice and humans with CF. The present study confirms the results of Gawenis et al. (2001) that hypomineralized enamel was present in the incisors but not in the molars of the CF mice. Molecular analysis of cftr gene expression by RT-PCR shows expression in the molar tooth buds of normal mice (data not shown). The discrepancy between the tooth phenotype (only incisors being affected) and gene expression in molars and incisors could be due to the continuously erupting mouse incisor having numerous developmental differences from molars (e.g., rate of formation, continuous cell recruitment, different ion regulation, and iron incorporation). These differences could render the CF mouse incisor more sensitive to abnormal CFTR function. Alternatively, the CFTR channel could be used differently during incisor amelogenesis, compared with molar amelogenesis.

The exact mechanism of ion transport across the enamel organ into the matrix is not known, but passive diffusion and/or active transport in the form of anion channels, Na-K-2Cl co-transporters, bicarbonate-chloride exchangers, and anion exchangers likely play a role (Prostak and Skobe, 1996). Sodium, potassium, and chloride function as co-transporters in some transport epithelia (Prostak and Skobe, 1996). They may be involved in ion transport during enamel formation as well. The present study showed increased levels of potassium in the mature and secretory CF enamel, and significantly reduced amounts of chloride in the CF secretory enamel. A previous study with the use of neutron activation showed a significant reduction in chloride content of whole teeth but not in whole enamel, and showed no difference in the potassium content (Gawenis et al., 2001). While this previous study did not delineate between secretory and mature enamel, it is not surprising that differences between minor elements would quantitatively differ between these developmental stages, as shown in the present study. Indeed, electrolyte secretion and the mechanisms for controlling electrolyte flow likely vary between secretory and absorptive cells (Kunzelmann, 2001), possibly helping explain compositional differences between secretory- and maturation-stage ameloblasts and their respective tissues. The small sample size in the present study limited our power to detect differences in some elements because of their normal variability in amount. Further investigation on ion transport in the ameloblasts is required to elucidate the regulation and role of CFTR ion transport and movement during enamel formation.

The present study revealed a decreased calcium and calcium-to-phosphorus ratio in the CF mature enamel compared with the wild-type mature enamel. This is consistent with human CF enamel studies in which calcium is reduced while phosphorus was equivalent in CF enamel compared with normal mature enamel (Cua, 1991b). Similar Ca:P ratios for the CF (2.18) and normal (2.13) mouse enamel were observed on ashed specimens measured with atomic absorption spectrophotometry (Wright et al., 1996b), while a Ca:P ratio of 3.0 was determined by neutron activation (Gawenis et al., 2001). These discrepancies may be at least partially attributed to differences in the measurement techniques and the areas of tissue sampled (bulk vs. surface). The EDS results from the present study are similar to those reported for mature rat enamel studied by electron microprobe analysis (Halse, 1974). The decreased Ca:P ratio in mature CF enamel suggests the presence of an increased proportion of non-apatitic mineral or alteration in the prevalence of Ca and P ions in the unmineralized matrix. The present study and previous evaluations of CF mouse enamel consistently show a decreased amount of calcium in the CF mature enamel (Wright et al., 1996b; Gawenis et al., 2001). Indeed, chemical analysis of CF enamel shows that it contains only 52% mineral per volume, in contrast to wild-type enamel, which has about 81% mineral per volume (Wright et al., 1996b). Chemical analysis of mineral on a per volume basis provides the best measure of the degree of hypomineralization present in mature CF mouse incisor enamel.

The elemental composition for mature wild-type mouse enamel, as determined with EDS, corresponds closely to that reported for mature human enamel (Curzon and Cutress, 1983). One marked difference, however, is that the iron content in mouse enamel is markedly higher than that seen in human enamel, due to an iron-rich superficial layer in rodent enamel. This iron-rich layer is thought to be responsible for the yellow-brown pigmentation normally observed in rodent incisors (Mataki et al., 1991). Halse measured an iron gradient ranging from 10 to 20% iron by weight in the iron-containing outermost 10 to 20 µm of enamel to 0.1% by weight in the pigment-free layer in the continuously erupting rat incisor (Halse, 1974). In contrast to the study by Gawenis et al. (2001), the present study showed an increased iron content in CF mature mouse enamel compared with wild-type mouse enamel. This presents an interesting paradox, given that CF enamel is opaque white compared with the normal yellow-brown, despite having a normal-to-increased iron content. The reduced iron content reported previously (Gawenis et al., 2001) by bulk sample analysis with neutron activation could reflect a reduction in the iron content through the entire width of enamel and dentin. The pigmented enamel surface content of iron determined by EDS in the present study for both the CF and normal mice were similar to those reported previously for rats (Halse, 1974). Several explanations exist for the increased iron content compared with the normal mice. The increased level of iron could result from blood contamination of the CF sample. We believe that this is unlikely, given that all incisor preparations were identical, and we would expect an elevated iron level in the porous secretory CF enamel if there were serum contamination. Another possibility is that the marked reduction in CF mineral content and tissue density alters the area of x-ray excitation, causing the detection of iron to increase in relationship to the other ions. Our finding of iron levels in CF teeth, however, is consistent with those reported previously (Halse, 1974; Heap et al., 1983) and suggests that factors other than iron deficiency are involved in the white opaque coloration observed in CF incisors. The pigmentation change seen in CF incisors could result from changes in the mineral and organic components of the CF enamel, despite the presence of normal to increased iron content. For example, hypomineralization, such as that associated with fluorosis, produces pigmentation changes in rat incisor enamel (DenBesten and Heffernan, 1989). In the present study, the amount of fluoride was controlled through identical diets, suggesting that hypomineralization and not dietary fluoride probably contributes to the white opaque color of the CF teeth.

Enamel formation involves a complex cascade of events with many regulatory mechanisms. The exact mechanism by which abnormal CFTR expression results in pathological enamel formation remains unknown. However, it is possible that several important developmental pathways may be altered secondary to abnormal gene expression. During the secretory stage, the pH of rat enamel normally remains relatively constant at pH 7.23, but fluctuates between acidic and neutral pH from release of hydrogen ions during the maturation stage (Smith et al., 1996). Maintaining a physiologic pH during enamel mineralization, when massive amounts of hydrogen ions are being released, is essential for mineral deposition (Smith, 1998). One of the proposed buffering mechanisms of the enamel matrix fluid during mineralization is by the continuous release of bicarbonate into the enamel fluid (Smith, 1998). It has recently been proposed that altered bicarbonate transport by CFTR is critical in the pathogenesis of CF (Wine, 2001). Proteinase activity during enamel maturation is thought to be, in part, regulated by pH (Smith et al., 1996). Altered proteinase activity caused by an abnormal enamel fluid pH could affect amelogenin processing during CF enamel maturation and result in retained protein in the mature CF enamel, as has been reported (Wright et al., 1996a).

This study suggests that CFTR is important in enamel formation, although its specific function during tooth development is unknown and requires further study. It appears that enamel matrix secretion occurs normally in the CF mouse, with the subsequent events related to matrix processing and crystal growth being affected. Analysis of our data indicates that the cftr mRNA is present in developing odontogenic tissues, and that the CFTR ion transport system is likely critical for normal enamel formation in the mouse incisor. Further study of the role of CFTR in mice and humans is clearly indicated to understand CFTR's role in enamel formation and will provide important information regarding the regulation of normal enamel development and the role of this gene in abnormal enamel formation in humans with CF.


    ACKNOWLEDGMENTS
 
This study was supported in part by US Department of Health and Human Services Maternal Child Health Grant # 5 T17 MC 00015-10, and by NIDCR Grant # DE11725, Bethesda MD.

Received for publication December 6, 2001. Revision received April 29, 2002. Accepted for publication May 13, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Boat TF, Welsh MJ, Beaudet AL (1989). Cystic fibrosis. In: The metabolic basis of inherited disease. Scriver CR, editor. New York: McGraw-Hill, pp. 2649-2680.
  • Collins FS (1992). Cystic fibrosis: molecular biology and therapeutic implications. Science 256:774–779.[Abstract/Free Full Text]
  • Cooley RO (1970). Effects of cystic fibrosis and its treatment on the oral tissues and their environment (thesis). Chicago: Northwestern University.
  • Cua FT (1991a). Zinc in teeth from children with and without cystic fibrosis. Biol Trace Elem Res 29:229–237.[Medline] [Order article via Infotrieve]
  • Cua FT (1991b). Calcium and phosphorus in teeth from children with and without cystic fibrosis. Biol Trace Elem Res 30:277–289.[Medline] [Order article via Infotrieve]
  • Curzon MEJ, Cutress TW, editors (1983). Trace elements and dental disease. Postgraduate dental handbook. Vol. 9. Bristol, England: PSG Inc., pp. 33–91.
  • DenBesten PK, Heffernan LM (1989). Enamel proteases in secretory and maturation enamel of rats ingesting 0 and 100 ppm fluoride in drinking water. Adv Dent Res3:199–202.[Abstract/Free Full Text]
  • Gawenis LR, Spencer P, Hillman LS, Harline MC, Morris JS, Clarke LL (2001). Mineral content of calcified tissues in cystic fibrosis mice. Biol Trace Elem Res 83:69–81.[CrossRef][Medline] [Order article via Infotrieve]
  • Grubb BR, Boucher RC (1999). Pathophysiology of gene-targeted mouse models for cystic fibrosis. Physiol Rev 79(Suppl):S193–S214.[Medline] [Order article via Infotrieve]
  • Halse A (1974). Elemental composition of the superficial layer of rat incisor enamel. Calcif Tissue Res 16:139–144.[Medline] [Order article via Infotrieve]
  • Heap PF, Berkovitz BK, Gillett MS, Thompson DW (1983). An analytical ultrastructural study of the iron-rich surface layer in rat-incisor enamel. Arch Oral Biol 28:195–200.[Medline] [Order article via Infotrieve]
  • Jagels AE, Sweeney EA (1976). Oral health of patients with cystic fibrosis and their siblings. J Dent Res 55:991–996.
  • Kelley KA, Stamm S, Kozak CA (1992). Expression and chromosome localization of the murine cystic fibrosis transmembrane conductance regulator. Genomics 13:381–388.[CrossRef][Medline] [Order article via Infotrieve]
  • Kunzelmann K (2001). CFTR: interacting with everything? News Physiol Sci 16:167–170.[Abstract/Free Full Text]
  • Mataki S, Ohya K, Ino M, Ogura H (1991). Studies on the transport mechanism of iron in rat incisor enamel. In: Mechanisms and phylogeny of mineralization in biological systems. Tokyo: Springer-Verlag, pp. 298-301.
  • Primosch RE (1980). Tetracycline discoloration, enamel defects, and dental caries in patients with cystic fibrosis. Oral Surg Oral Med Oral Pathol 50:301–308.[Medline] [Order article via Infotrieve]
  • Prostak KS, Skobe Z (1996). Anion translocation through the enamel organ. Adv Dent Res 10:238–244.[Abstract/Free Full Text]
  • Smith CE (1998). Cellular and chemical events during enamel maturation. Crit Rev Oral Biol Med 9:128–161.[Abstract/Free Full Text]
  • Smith CE, Issid M, Margolis HC, Moreno EC (1996). Developmental changes in the pH of enamel fluid and its effects on matrix-resident proteinases. Adv Dent Res 10:159–169.[Abstract/Free Full Text]
  • Snouwaert JN, Brigman KK, Latour AM, Malouf NN, Boucher RC, Smithies O, et al. (1992). An animal model for cystic fibrosis made by gene targeting. Science 257:1083–1088.[Abstract/Free Full Text]
  • Wine, JJ (2001). Cystic fibrosis: the ‘bicarbonate before chloride’ hypothesis. Curr Biol 11:R463–R466.[CrossRef][Medline] [Order article via Infotrieve]
  • Wright JT, Kiefer CL, Hall KI, Grubb BR (1996a). Abnormal enamel development in a cystic fibrosis transgenic mouse model. J Dent Res 75:966–973.
  • Wright JT, Hall KI, Grubb BR (1996b). Enamel mineral composition of normal and cystic fibrosis transgenic mice. Adv Dent Res 10:270–275.[Abstract/Free Full Text]

Journal of Dental Research, Vol. 81, No. 7, 492-496 (2002)
DOI: 10.1177/154405910208100712


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. R. Gawenis, E. M. Bradford, V. Prasad, J. N. Lorenz, J. E. Simpson, L. L. Clarke, A. L. Woo, C. Grisham, L. P. Sanford, T. Doetschman, et al.
Colonic Anion Secretory Defects and Metabolic Acidosis in Mice Lacking the NBC1 Formula Cotransporter
J. Biol. Chem., March 23, 2007; 282(12): 9042 - 9052.
[Abstract] [Full Text] [PDF]


Home page
BMJHome page
J. Shepherd, D. C Reardon, P. Davies, and G. V Vimpani
Violence as a public health problem
BMJ, January 11, 2003; 326(7380): 104 - 104.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Arquitt, C.K.
Right arrow Articles by Wright, J.T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arquitt, C.K.
Right arrow Articles by Wright, J.T.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CALCIUM COMPOUNDS
*CALCIUM, ELEMENTAL
*IRON
*POTASSIUM
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?