|
Sign In to gain access to subscriptions and/or personal tools.
|
Tropoelastin Expression by Periodontal Fibroblasts
E. Tsuruga*,
K. Irie,
Y. Sakakura and
T. Yajima
Department of Oral Anatomy, School of Dentistry, Health Sciences University of Hokkaido, 1757 Kanazawa, Ishikari-Tobetsu, Hokkaido 061-0293, Japan;
Correspondence: *corresponding author, tsuru{at}hoku-iryo-u.ac.jp
 |
ABSTRACT
|
|---|
Elastic system fibers are load-bearing proteins found in periodontal tissue. There are three types—oxytalan, elaunin, and elastic fibers—which differ in their relative microfibril and elastin contents. Oxytalan fibers are known to be distributed in the periodontal ligaments and gingiva, whereas elaunin and elastic fibers are present only in the gingiva. We examined gene expression and accumulation of tropoelastin in the cell-matrix layers of human gingival fibroblasts (HGF) and periodontal ligament fibroblasts (HPLF) in vitro. HGF and HPLF were cultured in MEM containing 10% newborn calf serum for 8 wks. Northern blotting and RT-PCR analyses showed that only HGF expressed mRNA encoding tropoelastin. Western blotting analysis demonstrated 77-kDa protropoelastin and 68-kDa tropoelastin only in the cell-matrix layer of HGF cultured for 8 wks. These results suggest that the different tropoelastin expression patterns reflect the difference between HGF and HPLF phenotypes.
Key Words: tropoelastin • gene expression • gingiva • periodontal ligaments • fibroblast phenotype
|
INTRODUCTION
|
|---|
The elastic system fiber network is the major component of the extracellular matrix, providing elasticity to tissues. Elastic system fibers are composed of two components, elastin and microfibrils (Mecham and Davis, 1994). Depending upon the relative proportions and morphological arrangement of these two molecules, three types of elastic system fiber can be identified: elastic, elaunin, and oxytalan fibers (Böck and Stockinger, 1984). Elastic fibers contain a relatively large amount of elastin, whereas elaunin fibers contain very little. By contrast, oxytalan fibers are bundles of pure microfibrils.
Periodontal tissue consists of the gingiva, periodontal ligaments (PDL), cementum, and bone lining the alveolus. It is of interest that oxytalan fibers are the only recognized components of elastic system fibers in human PDL (Simmons and Avery, 1980; Sculean et al., 1999) and other mammalian PDL (Edmunds et al., 1979; Takagi et al., 1985), whereas all three types of fibers are found in the gingiva of humans (Chavrier et al., 1988) and other mammals (Soames and Davies, 1975; Bourke et al., 2000). Although elastin deposition has not been detected within the PDL, Johnson and Pylypas (1992) described the distribution of an elastic meshwork composed of both oxytalan and elaunin fibers in murine PDL. Furthermore, Palmon et al. (2001) demonstrated that human PDL fibroblasts (HPLF) expressed tropoelastin mRNA in vitro. However, we found that tropoelastin and microfibrils were secreted into the culture-conditioned medium of human gingival fibroblasts (HGF), but only microfibrils were secreted into the medium of HPLF (Tsuruga et al., 2002). Thus, further investigation of tropoelastin gene expression by HGF and HPLF seems worthwhile.
To improve our understanding of the difference between elastic system fiber metabolism in the gingiva and that in the PDL, we investigated tropoelastin gene expression by HGF and HPLF in culture and compared the amounts of tropoelastin accumulated in the cell-matrix layers of these two types of fibroblasts.
|
MATERIALS & METHODS
|
|---|
Cells and Culture
The protocol for these experiments was reviewed and approved by the Health Sciences University of Hokkaido Research Ethics Committee, and informed consent was obtained from the tissue donors.
HGF and HPLF were isolated and cultured as described previously (Giannopoulou and Cimasoni, 1996). Briefly, the cells were harvested from the healthy gingiva and PDL of a molar extracted for orthodontic reasons from each of three different persons (ages 17, 19, and 20 yrs) and then cultured in Minimum Essential Medium (MEM; ICN Biomedicals Inc., Aurora, OH, USA) supplemented with non-essential amino acids (ICN Biomedicals Inc., Aurora, OH, USA) and 10% newborn calf serum (NCS; Life Technologies, Grand Island, NY, USA) at 37°C in humidified air containing 5% CO2. For experiments, the cells were trypsinized and seeded at 1 x 106 cells per 60-mm culture dish (Corning Co., Cambridge, MA, USA) in MEM supplemented with non-essential amino acids, 10% NCS, 100 U/mL penicillin, and 100 µg/mL streptomycin. Cells from the third to fifth passages of culture were used, and three samples of each person's HGF and HPLF from cell cultures at the same passage were compared. The results of all the comparisons in each experiment were similar. The medium was collected and refreshed (5 mL/dish) every 3 days. The cell-matrix layer was harvested 2, 4, and 8 wks after confluence, and RNA and proteins were extracted.
RNA Extraction and Reverse-transcription/Polymerase Chain-reaction (RT-PCR)
To examine tropoelastin mRNA expression, sample RNA was extracted from HGF and HPLF after culture for 4 wks by means of a RNeasy Mini Kit (Qiagen, Hilden, Germany), as described previously (Haase et al., 1998). Using the extracted RNA as a template, we carried out reverse-transcription reactions with a SuperScriptTM First-Strand complementary DNA (cDNA) Synthesis System (Life Technologies, Grand Island, NY, USA). Briefly, a 5-µg aliquot of RNA was used as a template for first-strand cDNA synthesis in a 20-µL reaction mixture containing 500 µM dNTPs, 500 ng oligo(dT), 5 U RNase inhibitor, 10 mM dithiothreitol, 6 mM MgCl2, 50 mM KCl, 20 mM Tris-HCl, pH 8.2, and 200 U SuperScript II reverse transcriptase. The reaction mixture was incubated at 42°C for 50 min, after which the reaction was stopped by heating of the mixture at 70°C for 15 min. The cDNA was stored at –20°C until required.
Each PCR was carried out in 50 µL buffer (10 mM Tris-HCl, pH 8.7, 50 mM KCl, 1.5% Triton X-100, 1.5 mM MgCl2) containing: 100 ng of prepared cDNA as the template; 2.5 U HotStarTag DNA Polymerase (Qiagen, Germany); 200 µM each of dNTP and 100 pM of each primer; and tropoelastin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; a housekeeping gene). For sequences of tropoelastin from 5' to 3', oligonucleotide primers were used (forward, CGGAATTCACCTCTTAAGCCAGTTCCCG; reverse, CCCAAGCTTCGGGAACACCTCCGACACTA), whose base sequences were determined from those of the human elastin gene (Indik et al., 1987). The product size was 1100 bp. PCR amplification was performed for 25 cycles in a thermal cycler (Takara PCR, Thermal Cycler Personal, Takara Biochemicals, Tokyo, Japan) with initial denaturation at 94°C for 1 min, with subsequent annealing at 58°C for 1 min, and extension at 72°C for 1 min. The PCR products were then analyzed by electrophoresis with 1% agarose gels, followed by ethidium bromide staining. Three cDNA samples (from different donors) were analyzed, and a minimum of three PCR reactions was carried out for each cDNA sample. All the experiments yielded similar results.
Preparation of Plasmids and cDNA Templates for Riboprobe Synthesis
Templates for tropoelastin were obtained by PCR with HGF cDNA at 4 wks (described above). The PCR products were ligated into the pT7/T3- 18 vector (Life Technologies, Grand Island, NY, USA). The plasmid was linearized with Hind III, and then T7 RNA polymerase in the presence of digoxigenin (DIG)-labeled nucleotides (Roche Molecular Biochemicals, Mannheim, Germany), to generate the DIG-labeled 1100-bp RNA probe of human tropoelastin.
Northern Blotting Analysis
Total RNA was extracted from HGF and HPLF cultures after 2, 4, and 8 wks by means of an RNeasy Mini Kit (Qiagen, Germany), as described above. Aliquots (2 µg) of RNA were separated by 1% denaturing agarose gel electrophoresis in 3[N-morpholino]propanesulfonic acid buffer, transferred to a nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ, USA), and cross-linked to the membrane in a UV cross-linker (Stratagene, La Jolla, CA, USA). Then, the RNA was pre-hybridized in hybridization buffer (DIG Easy Hyb, Roche Molecular Biochemicals, Germany) at 68°C for 1 hr, followed by hybridization with the labeled probe (50 ng probe/mL) in the same buffer for 18 hrs at 68°C. The membrane was washed with 2 x SSC (1 x SSC is 180 mM NaCl and 15 mM sodium citrate) containing 0.1% sodium dodecyl sulfate (SDS) for 10 min at room temperature, followed by 0.3 x SSC containing 0.1% SDS for 30 min at 68°C. We detected the hybridized probe signals by binding with anti-DIG alkaline phosphatase conjugate in accordance with the manufacturer's instructions (Roche Molecular Biochemicals), using CDP Star as the enzyme substrate and capturing the results on x-ray film. The exposed x-ray films were scanned, and densitometric analysis of the signals was performed by means of the NIH Image program (National Institutes of Health, Bethesda, MD, USA). Small variations in RNA loading were corrected by normalization relative to the intensity of the band obtained after the membrane was re-probed with a DIG-labeled β-actin RNA probe (Roche Molecular Biochemicals, Germany). According to the manufacturer, the lower limit of detection of this Northern blotting system is 0.03 pg RNA. Each value presented is expressed as the mean ± standard deviation (SD), and all quantitative results represent at least three independent analyses.
Extraction of Soluble Tropoelastin from the Cell-Matrix Layer
Soluble elastin was extracted from the cell-matrix layer by the method of experimental design (Sandberg et al., 1975). All procedures were performed at 4°C. The cell-matrix layers were washed with phosphate-buffered saline (PBS) containing protease inhibitors (5 mM ethylenediaminetetraacetic acid, 50 µM N-ethylmaleimide, and 50 µM phenylmethylsulfonyl fluoride). Each cell-matrix layer was harvested in 2 mL 0.5 M ammonium sulfate, pH 7.0 (containing protease inhibitors), with the aid of a plastic cell scraper. The cell-matrix layer was then homogenized and centrifuged at 15,000 x g for 30 min. The supernatant was removed and the pellet re-suspended in one-half volume of ammonium sulfate buffer and re-centrifuged. The supernatants from the first and second centrifugations were combined, dialyzed against distilled water, and then lyophilized. The lyophilized material was dissolved in PBS at a concentration of 5 mg/mL and brought to 40% in ammonium sulfate by the slow addition of solid ammonium sulfate. The precipitate was collected by centrifugation, solubilized in 0.5 M ammonium formate, pH 5.5, and dialyzed overnight against the same buffer containing proteinase inhibitors. One and one-half volumes of 1-propanol were slowly added dropwise to one volume of the ammonium formate-protein solution, followed by the dropwise addition of 2.5 volumes of 1-butanol. After being stirred overnight, the material was filtered; the filtrate was dried, washed with chloroform, and solubilized in 0.02 N formic acid. The formic acid solution was dialyzed against 0.02 N formic acid, pH 3.5, and lyophilized.
Western Blotting Analysis
Lyophilized samples (100 µg) of cell-matrix layers were mixed with a gel electrophoresis loading buffer (2% SDS, 62 mM Tris, 10% glycerol, and 600 mM dithiothreitol, pH 7.0), boiled at 100°C for 3 min, and then subjected to electrophoresis on 10% polyacrylamide gel. The electrophoresed proteins were transferred to an Immobilon-P membrane (Millipore, Bedford, MA, USA), placed in a tank blotter containing 25 mM Tris/192 mM glycine, pH 8.3, and electrophoresed at 15 V for 2 hrs. Then, the Immobilon-P membrane was blocked with Block Ace (Dainippon Pharmaceuticals, Osaka, Japan) for 2 hrs and incubated with an anti-human polyclonal tropoelastin antibody (Elastin Products Co., Owensville, MO, USA), which was raised in rabbits against synthetic peptides representing the amino acid sequence of the predicted epitopes in human tropoelastin, diluted 1:500 with 10% Block Ace. The blotted membrane was incubated for 1 hr with horseradish peroxidase–conjugated sheep anti-rabbit Ig(F[ab']2) (Amersham Pharmacia Biotech, Piscataway, NJ, USA) diluted 1:5000 with 10% Block Ace, and the antigens were visualized by means of an ECL kit (Amersham Pharmacia Biotech, Little Chalfont, UK). The lower limit of detection of this ECL Western blotting system is 0.2 pg protein.
Pre-stained SDS-polyacrylamide gel electrophoresis molecular-mass markers (Bio-Rad Laboratories, Hercules, CA, USA) were run with each blot.
Protein content was quantified with the BCA protein assay system (Pierce Chemical Co., Rockford, IL, USA).
Amido Black Staining of Membranes
Immobilon-P membranes were stained in 0.1% (w/v) Amido Black 10B (Wako Pure Chemicals, Osaka, Japan), 10% acetic acid, and 20% methanol, and de-stained in 10% acetic acid.
|
RESULTS
|
|---|
Expression of Tropoelastin Gene
Northern blots of tropoelastin mRNA expressed by HGF and HPLF harvested after culture for 2, 4, and 8 wks are shown in Fig. 1A . A 3.5-kb mRNA was detected in HGF, but not in HPLF. The tropoelastin mRNA to β-actin mRNA ratio was determined by densitometric analysis of the Northern blotting data, and the results obtained from three separate experiments are shown in the graph in Fig. 1B. The densitometric units of four-week HGF samples were arbitrarily assigned a value of 100%, and the densitometric units for the other HGF samples are presented as percentages of those for the four-week HGF samples shown in Fig. 1B. Slight induction of tropoelastin mRNA expression by HGF was evident after culture for 2 wks, expression increased up to 4 wks, and by 8 wks had decreased to half the level at 4 wks.
View larger version (34K):
[in this window]
[in a new window]
|
Figure 1. Tropoelastin mRNA expression by HGF and HPLF. (A) Northern blotting analysis. HGF and HPLF were harvested at different times, as indicated. Total cell RNA was prepared, and 2 µg was analyzed by Northern blotting, as described in MATERIALS & METHODS. The top panel shows a representative Northern blot probed for tropoelastin mRNA expression, after which the blot was stripped and re-probed for β-actin mRNA expression (bottom panel). (B) The bands in (A) were analyzed densitometrically, and the HGF tropoelastin mRNA to β-actin mRNA ratios are plotted on a bar graph. The results are expressed as percentages relative to the four-week value and represent the means ± SD (standard deviation) of three independent experimental determinations. (C) Photograph of ethidium-bromide-stained 1% agarose electrophoresis gels showing the RT-PCR products of mRNAs extracted from HGF and HPLF after culture for 4 wks. A tropoelastin band from the HGF sample appearing at 1100-bp sites is present in lane 1. No detectable tropoelastin band was obtained from HPLF (lane 3). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) bands from HGF and HPLF samples appeared at 998-bp sites in lanes 2 and 4, respectively. The molecular mass standards (lane STD) were Lambda DNA/(EcoRI and HindIII) fragments.
|
|
Next, we carried out RT-PCR analysis using cDNA from HGF and HPLF cultured for 4 wks, and Fig. 1C shows the agarose gel electrophoresis patterns of mRNA expression. A tropoelastin band (1100 bp) was detected in lane 1, which contained the four-week HGF sample, but no such band was yielded by four-week HPLF samples (lane 3). GAPDH expression (control) by both HGF and HPLF samples was detected as a band corresponding to 998 bp (lanes 2 and 4, respectively). These results agreed with the Northern blotting data, confirming that HPLF expressed little or no tropoelastin mRNA.
Detection of Tropoelastin in the HGF Cell-Matrix Layer
Western blotting analysis with an anti-human tropoelastin antibody demonstrated that the tropoelastin in the cell-matrix layer secreted by HGF was detectable as 77-kDa and 68-kDa bands (Fig. 2). Both bands were stably detected at 8 wks, while the 68-kDa band was mainly detected at 4 wks. A faint 68-kDa band was observed at 2 wks. However, the bands characteristic of tropoelastin were absent in the HPLF cell-matrix layer throughout the eight-week experimental period. By staining the membranes with Amido Black, we confirmed that equal amounts of protein had been loaded in each lane.
View larger version (68K):
[in this window]
[in a new window]
|
Figure 2. Immunoblotting of tropoelastin (upper panel). HGF and HPLF underwent lysis at the indicated times, and equal amounts of protein (100 µg) were separated by SDS-PAGE and transferred to PVDF membranes. The blots were probed with an anti-tropoelastin antibody and developed with ECL reagent. To ensure that equivalent amounts of extracted proteins were present in each lane, we stained another PVDF membrane with Amido Black 10B reagent before hybridization (lower panel). The results are representative of three independent experiments.
|
|
|
DISCUSSION
|
|---|
Elastic system fibers are complex structures of the extracellular matrix. However, the mechanism that determines the proportion of elastin within the gingiva and PDL has been unclear. Elastogenesis is thought to occur by the laying down of cross-linked elastin onto previously deposited microfibrils (Cleary and Gibson, 1983; Mecham and Davis, 1994). Judging from our previous work (Tsuruga et al., 2002), it is speculated that tropoelastin secretion, rather than microfibrils, is a factor determining the different distributions of elastic system fibers between gingiva and PDL. As shown in Fig. 1, Northern blotting analysis indicated that HGF cultured for 8 wks expressed tropoelastin mRNA, whereas no tropoelastin mRNA was detected in HPLF cultures. RT-PCR analysis detected no tropoelastin mRNA expression by HPLF cultured for 4 wks, thus supporting the Northern blotting data. HPLF have been reported to express tropoelastin at both the mRNA (Palmon et al., 2001) and protein (Howard et al., 1998) levels. Since PDL cells contain a heterogeneous population of fibroblasts (Somerman et al., 1988; Piche et al., 1989; Arceo et al., 1991), different tropoelastin mRNA levels may be attributable to the heterogeneity of PDL fibroblasts. The amount of tropoelastin secreted by fibroblasts was found to decline as the passage number or donor age increased (Sephel and Davidson, 1986; Sephel et al., 1987). Although we used HGF and HPLF between the 3rd and 5th passages in this study, we observed no differences in tropoelastin mRNA expression levels between the 1st and 5th passages of these cells (data not shown). With respect to donor age, we used cells from donors aged 17-20 yrs. Therefore, more detailed experiments on cells from subjects of a wider age range will have to be done before conclusions can be drawn.
It is known that the turnover of elastic fiber is very slow, with a half-life estimated to be the lifetime of the animal (Lefevre and Rucker, 1980). Previously, we have demonstrated ultrastructurally, by culturing HGF for 6 wks, that oxytalan and elaunin fibers develop in the cell-matrix layer (Kunimoto et al., 1999). A marked decline of tropoelastin mRNA level from 4 wks to 8 wks may be explained by the speculation by Lefevre and Rucker (1980) that once the total pool of tropoelastin is stabilized as mature elastic fibers, there is no measurable turnover or resynthesis.
We also demonstrated that soluble tropoelastin in the cell-matrix layer was detected in HGF, not in HPLF (Fig. 2). Western blot analysis showed that the tropoelastin antibody reacted with molecular masses of 77-kDa and 68-kDa proteins. It is reported that the 77-kDa molecule of the cell-matrix layer is protropoelastin, which is a secretory form of elastin (Chipman et al., 1985; Franzblau et al., 1989). Protropoelastin is extracellularly processed into 68-kDa tropoelastin, which is in turn incorporated into the elastic fibers (Chipman et al., 1985). Tropoelastin in the cell-matrix layer was detected at 2 wks as a faint 68-kDa band. We have recently reported that the tropoelastin in the medium secreted by HGF was detectable from 3.5 wks (Tsuruga et al., 2002). Our results support those of Chipman et al. (1985), who found that, by culturing smooth-muscle cells, they could detect soluble elastin in cell-matrix layers much earlier than it appears in the medium.
Although very little has been available in the published literature on the elaunin fiber in PDL, Johnson and Pylypas (1992) reported the existence of elastic meshwork in mouse PDL by sodium hydroxide digestion. Further investigations are necessary to clarify more precisely the existence of elaunin fiber in PDL by immunohistochemical methods.
In conclusion, HGF in culture expressed the tropoelastin gene and accumulated tropoelastin in the cell-matrix layer, whereas HPLF did not. These results suggest that this difference in tropoelastin expression reflects the difference between HGF and HPLF phenotypes, resulting in different distributions of elastic system fibers in gingiva and PDL in vivo.
|
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Itaru Mizoguchi (Department of Orthodontics, School of Dentistry, Health Sciences University of Hokkaido) for helpful discussions. This study was partially supported by grants-in-aid from the Health Sciences University of Hokkaido (to E.T.) and Grants-in-Aid for Scientific Research (No. 11307051) from the Ministry of Education, Science, Sports and Culture of Japan.
Received for publication August 3, 2001.
Revision received December 27, 2001.
Accepted for publication January 15, 2002.
|
REFERENCES
|
|---|
- Arceo N, Sauk JJ, Moehring J, Foster RA, Somerman MJ (1991). Human periodontal cells initiate mineral-like nodules in vitro. J Periodontol 62:499–503.[Medline]
[Order article via Infotrieve]
- Böck P, Stockinger L (1984). Light and electron microscopic identification of elastic, elaunin and oxytalan fibers in human tracheal and bronchial mucosa. Anat Embryol (Berl) 170:145–153.[CrossRef][Medline]
[Order article via Infotrieve]
- Bourke KA, Haase H, Li H, Daley T, Bartold PM (2000). Distribution and synthesis of elastin in porcine gingiva and alveolar mucosa. J Periodontal Res 35:361–368.[Medline]
[Order article via Infotrieve]
- Chavrier C, Hartmann DJ, Couble ML, Herbage D (1988). Distribution and organization of the elastic system fibres in healthy human gingiva. Ultrastructural and immunohistochemical study. Histochemistry 89:47–52.[CrossRef][Medline]
[Order article via Infotrieve]
- Chipman SD, Faris B, Barone LM, Pratt CA, Franzblau C (1985). Processing of soluble elastin in cultured neonatal rat smooth muscle cells. J Biol Chem 260:12780–12785.[Abstract/Free Full Text]
- Cleary EG, Gibson MA (1983). Elastin-associated microfibrils and microfibrillar proteins. Int Rev Connect Tissue Res 10:97–209.[Medline]
[Order article via Infotrieve]
- Edmunds RS, Simmons TA, Cox CF, Avery JK (1979). Light and ultrastructural relationship between oxytalan fibers in the periodontal ligament of the guinea pig. J Oral Pathol 8:109–120.[Medline]
[Order article via Infotrieve]
- Franzblau C, Pratt CA, Faris B, Colannino NM, Offner GD, Mogayzel PJ Jr, et al. (1989). Role of tropoelastin fragmentation in elastogenesis in rat smooth muscle cells. J Biol Chem 264:15115–15119.[Abstract/Free Full Text]
- Giannopoulou C, Cimasoni G (1996). Functional characteristics of gingival and periodontal ligament fibroblasts. J Dent Res 75:895–902.
- Haase HR, Clarkson RW, Waters MJ, Bartold PM (1998). Growth factor modulation of mitogenic responses and proteoglycan synthesis by human periodontal fibroblasts. J Cell Physiol 174:353–361.[CrossRef][Medline]
[Order article via Infotrieve]
- Howard PS, Kucich U, Taliwal R, Korostoff JM (1998). Mechanical forces alter extracellular matrix synthesis by human periodontal ligament fibroblasts. J Periodontal Res 33:500–508.[Medline]
[Order article via Infotrieve]
- Indik Z, Yoon K, Morrow SD, Cicila G, Rosenbloom J, Rosenbloom J, et al. (1987). Structure of the 3' region of the human elastin gene: great abundance of Alu repetitive sequences and few coding sequences. Connect Tissue Res 16:197–211.[Medline]
[Order article via Infotrieve]
- Johnson RB, Pylypas SP (1992). A re-evaluation of the distribution of the elastic meshwork within the periodontal ligament of the mouse. J Periodontal Res 27:239–249.[CrossRef][Medline]
[Order article via Infotrieve]
- Kunimoto H, Fujii S, Irie K, Sakakura Y, Yajima T (1999). Ultrastructural study of the fibrogenesis of elastic system fibers by human gingival fibroblasts in vitro. Jpn J Oral Biol 41:235–244.
- Lefevre M, Rucker RB (1980). Aorta elastin turnover in normal and hypercholesterolemic Japanese quail. Biochim Biophys Acta 630:519–529.[Medline]
[Order article via Infotrieve]
- Mecham R, Davis E (1994). Extracellular matrix assembly and structure. In: Elastic fiber structure and assembly. Yurchenco P, Birk D, Mecham R, editors. New York: Academic Press, pp. 281-314.
- Palmon A, Roos H, Reichenberg E, Grosskop A, Bar Kana I, Pitaru S, et al. (2001). Basic fibroblast growth factor suppresses tropoelastin gene expression in cultured human periodontal fibroblasts. J Periodontal Res 36:65–70.[CrossRef][Medline]
[Order article via Infotrieve]
- Piche JE, Carnes DL Jr, Graves DT (1989). Initial characterization of cells derived from human periodontia. J Dent Res 68:761–767.
- Sandberg LB, Bruenger E, Cleary EG (1975). Tropoelastin purification: improvements using enzyme inhibitors. Anal Biochem 64:249–254.[Medline]
[Order article via Infotrieve]
- Sculean A, Donos N, Windisch P, Reich E, Gera I, Brecx M, et al. (1999). Presence of oxytalan fibers in human regenerated periodontal ligament. J Clin Periodontol 26:318–321.[CrossRef][Medline]
[Order article via Infotrieve]
- Sephel GC, Davidson JM (1986). Elastin production in human skin fibroblast cultures and its decline with age. J Invest Dermatol 86:279–285.[CrossRef][Medline]
[Order article via Infotrieve]
- Sephel GC, Buckley A, Davidson JM (1987). Developmental initiation of elastin gene expression by human fetal skin fibroblasts. J Invest Dermatol 88:732–735.[CrossRef][Medline]
[Order article via Infotrieve]
- Simmons TA, Avery JK (1980). Electron dense staining affinities of mouse oxytalan and elastic fibers. J Oral Pathol 9:183–188.[Medline]
[Order article via Infotrieve]
- Soames JV, Davies RM (1975). Elastic and oxytalan fibres in normal and inflamed dog gingivae. J Periodontal Res 10:309–314.[Medline]
[Order article via Infotrieve]
- Somerman MJ, Archer SY, Imm GR, Foster RA (1988). A comparative study of human periodontal ligament cells and gingival fibroblasts in vitro. J Dent Res 67:66–70.
- Takagi M, Yagasaki H, Baba T, Baba H (1985). Ultrastructural visualization of carbohydrates in oxytalan fibers in monkey periodontal ligaments. J Histochem Cytochem 33:1007–1014.[Abstract]
- Tsuruga E, Irie K, Sakakura Y, Yajima T (2002). Expression of fibrillins and tropoelastin by human gingival and periodontal ligament fibroblasts in vitro. J Periodontal Res (in press).
Journal of Dental Research, Vol. 81, No. 3,
198-202 (2002)
DOI: 10.1177/154405910208100311
 CiteULike  Complore  Connotea  Del.icio.us  Digg  Reddit  Technorati  Twitter What's this?
This article has been cited by other articles:
|
|
|
|
 
T. Sawada, Y. Sugawara, T. Asai, N. Aida, T. Yanagisawa, K. Ohta, and S. Inoue
Immunohistochemical Characterization of Elastic System Fibers in Rat Molar Periodontal Ligament
J. Histochem. Cytochem.,
October 1, 2006;
54(10):
1095 - 1103.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
TOP
ABSTRACT
INTRODUCTION