Advanced Search

Journal Navigation

Journal Home

Subscriptions

Archive

Contact Us

Table of Contents

Click here to sign up for SAGE Journal Email Alerts today!

Sign In to gain access to subscriptions and/or personal tools.
Journal of Dental Research
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Webb, S.J.
Right arrow Articles by Koka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webb, S.J.
Right arrow Articles by Koka, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Biological

Regulation of TNF-{alpha}-induced IL-6 Production in MG-63 Human Osteoblast-like Cells

S.J. Webb1, J.R. McPherson2, K. Pahan3 and S. Koka*,3

1 Formerly Dept. of Oral Biology, UNMC, and presently Dept. of Orthodontics, The Ohio State University, Columbus, OH;
2 formerly Dept. of Oral Biology, UNMC, and presently in private practice, Roseburg, OR;
3 Dept. of Oral Biology, UNMC, 40th & Holdrege Sts., Lincoln, NE 68583;

Correspondence: *corresponding author, skoka{at}unmc.edu


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor necrosis factor-{alpha} (TNF-{alpha}) stimulates osteoblast production of interleukin-6 (IL-6), an inflammatory cytokine implicated in osteoclastic bone resorption. Therefore, we tested the hypothesis that TNF-{alpha}-induced IL-6 production in MG-63 osteosarcoma cells occurs via the p38 mitogen-activated protein kinase (MAPK) pathway. TNF-{alpha} activated p38 MAPK and stimulated IL-6 secretion by MG-63 cells, and pre-incubation of cells with the p38 MAPK inhibitor abrogated TNF-{alpha}-dependent IL-6 secretion. Transfection of IL-6 full-length and 5'-deletion gene promoter reporter constructs indicated that p38 MAPK activation by TNF-{alpha} enhanced IL-6 gene expression, and that the p38 MAPK-responsive region resided in the proximal 260-bp segment. Transfection of NF{kappa}B and C/EBPβ-sensitive reporter promoter constructs demonstrated that NF{kappa}B activity was enhanced and that constitutive C/EBPβ was inhibited by TNF-{alpha}, with both effects being p38 MAPK-dependent. In conclusion, although p38 MAPK activation by TNF-{alpha} stimulates IL-6 secretion by MG-63 cells, it has opposing effects on c/EBPβ and NF{kappa}B activity.

Key Words: map kinase • interleukin-6 • osteoblast • inflammation


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor necrosis factor alpha (TNF-{alpha}) is a pro-inflammatory cytokine found in increased concentrations in inflamed tissues, such as those encountered in arthritis and periodontal disease, and has been found to stimulate bone resorption (Thomson et al., 1987; Ishimi et al., 1990). At sites of inflammation, osteoblasts of the periosteum react to these inflammatory mediators and consequently produce the cytokine interleukin-6 (IL-6) (Manolagas, 1995). Interleukin-6 is a multifunctional cytokine involved in osteoclast recruitment and differentiation into mature osteoclasts. Osteoblast-derived IL-6, in particular, is crucial to bone remodeling (Chambers and Fuller, 1985; Fuller et al., 1991), since excess IL-6 production predisposes to increased osteoclast number (Ishimi et al., 1990; Rozen et al., 2000).

The mitogen-activated protein kinase (MAPK) family of proteins is involved in intracellular signaling pathways, and three major families of MAPKs have been described in higher eukaryotes (Latchman, 1998). The effects of MAPK activation are varied and include cell proliferation, differentiation, and secretion of cytokines and growth factors (Thomson et al., 1999). The three MAPK families are: (1) the ERK (extracellular signal-related kinase) pathway; (2) the JNK/SAPK (c-Jun NH2-terminal kinase/stress-activated protein kinase) pathway; and (3) the p38 MAPK pathway. To be activated, ERK, JNK/SAPK, and p38 MAPK must be phosphorylated by dual-specificity kinases (MAP Kinase Kinases) on threonine and tyrosine residues within a highly conserved phosphorylation motif T-X-Y, where X is E for ERK, P for JNK/SAPK, and G for p38 MAPK (Latchman, 1998). In response to various stimuli, osteoblasts utilize MAPK-dependent pathways to modulate immediate early-gene induction (Siddhanti et al., 1995; Verheijen and Defize, 1995; Chaudhary and Avioli, 1997,1998;Miyazawa et al., 1998; Miwa et al., 1999). Previous reports suggest that TNF-{alpha} stimulates ERK, JNK, and/or p38 MAPK to differing degrees, depending upon the cell type investigated and the nature of the stimulation (Vanden Berghe et al., 2000.). In general, the ERK cascade preferentially regulates cell growth and differentiation, while the JNK and p38 MAPK cascades are associated more often with stress responses such as inflammation. However, the role of TNF-{alpha}-activated p38 MAPK in IL-6 production by osteoblasts of human origin is poorly understood.

The majority of evidence regarding IL-6 gene expression indicates that the transcription factor NF{kappa}B is the principal regulator of transcription (Vanden Berghe et al., 2000). However, in certain cell types, the activity of the transcription factors C/EBPβ and activator protein-1 (AP-1) also influences IL-6 gene expression (Akira and Kishimoto, 1992) (Fig. 1Go). A variety of transcription factors is initially activated as a result of MAPK pathways, and TNF-{alpha}, again depending upon cell type, can activate one or more MAPK pathways. Therefore, the p38 MAPK pathway, its activation by TNF-{alpha} in human osteoblast-like cells, and its effect on IL-6 production and on transcription factors that modulate IL-6 gene expression form the focus of this study.


Figure 1
View larger version (13K):
[in this window]
[in a new window]

 
Figure 1. Topographic representation of the human IL-6 gene promoter (phIL-6 WT) along with 5'deletions phIL-6A (-490 to +10) and phIL-6B (-260 to +10).

 

    MATERIALS & METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials and Cell Culture
Human osteosarcoma osteoblast-like cells, MG-63 (ATCC, Rockville, MD, USA), were cultured in RPMI 1640 (Sigma Chemical Co., St. Louis, MO, USA) plus 10% FBS (Hyclone, Logan, UT, USA), 100 mg/mL penicillin, 50 mg/mL streptomycin, and 2 mM sodium pyruvate (all Sigma). Cells were incubated in T-75 flasks (Falcon, Franklin Lakes, NJ, USA) at 37°C in a 95% air/5% CO2 atmosphere until 80-90% confluent and passaged at a 1:4 split ratio by means of 0.2 M trypsin/1 mM EDTA (Sigma) in phosphate-buffered saline. The p38 MAPK inhibitor SB203580 hydrochloride was purchased from Calbiochem (San Diego, CA, USA). Recombinant human TNF-{alpha} was purchased from Pharmingen, Inc. (San Diego, CA, USA). All hIL-6 enzyme-linked immunosorbent assay (ELISA) reagents were purchased from Pharmingen (San Diego, CA, USA), except for 2,2'azino-bis-(3-ethylbenzthiazoline-sulfonic acid) (ABTS) and hydrogen peroxide (Sigma).

IL-6 Secretion
MG-63 cells were plated in 16-mm plastic wells (24-well plates) at a density of 5 x 104 cells/mL per well and incubated overnight. Media were removed and replaced with 1 mL of RPMI 1640 with 0.1% FBS and with various concentrations of TNF-{alpha} and incubated for 24 or 48 hrs. For experiments involving inhibitor, cells were plated and incubated overnight (same as above) prior to the replacement of media with 1 mL of RPMI 1640 with 0.1% FBS and inhibitors. Cells were incubated for 60 min with various concentrations of SB203580 HCl (10, 5, and 1 µM) prior to stimulation with TNF-{alpha} (10 ng/mL) for 24 hrs. Supernatants were collected and stored at -70°C until IL-6 enzyme-linked immunosorbent assay.

ELISA for Human IL-6
Briefly, 96-well plates were coated with 50 µL of anti-cytokine capture antibody (2 µg/mL) and incubated overnight at 4°C. After being washed with PBS/Tween and blocked with PBS/10% FBS, 100 µL of experimental supernatants or standards were plated and incubated overnight at 4°C. After being washed, 100 µL of biotinylated anti-cytokine detecting antibody (1 µg/mL) were added and allowed to incubate for 1 hr at room temperature. Plates were washed prior to the addition of 100 µL of streptavidin-horseradish peroxidase enzyme and incubation at room temperature for 30 min. After being washed, 100 µL of ABTS substrate solution supplemented with hydrogen peroxide were added and incubated at room temperature for 30-45 min prior to optical density readings at 405 nm referenced to 490 nm. For each experimental culture well, duplicate ELISA readings were obtained. Sample IL-6 concentrations were interpolated from a linear fit standard curve calculated from known values of IL-6 ranging from 31 pg/mL to 2000 pg/mL.

Activation of p38 MAPK by TNF-{alpha}
MG-63 cells were plated in 35-mm plastic wells at a density of 3 x 105 cells/mL per well and allowed to attach overnight prior to a 24-hour serum starvation. Media were removed and replaced with 1 mL of RPMI 1640 with 0.1% FBS and with TNF-{alpha} (20 ng/mL) and incubated for 0, 5, 10, 15, 30, and 45 min. To confirm inhibition of p38 MAPK phosphorylation by SB203580 HCl, we plated MG-63 cells and incubated them overnight (same as above) prior to replacing media with 1 mL of RPMI 1640 with 0.1% FBS and inhibitor. Cells were incubated for 60 min with SB203580 HCl (10 µM) prior to stimulation with TNF-{alpha} (20 ng/mL) for 5 min.

Western Blotting
We placed plates on liquid nitrogen for 1 min to snap-freeze cells, prior to adding 400 µL of lysis buffer (50 mM HEPES, pH 7.8, 1% Triton, 1 mM EDTA, 30 mM sodium pyrophosphate, 1 mM sodium vanadate, 10 mM sodium fluoride, 1 µM phenylmethylsulfonyl fluoride, 20 ng/mL aprotinin). Lysates were vortexed and centrifuged to "pellet" detergent-insoluble cell debris. Protein content of lysates was determined by means of the BCA Protein Assay (Pierce, Rockford, IL, USA), and 4x SDS sample buffer was added to a volume containing approximately 200 µg of protein before samples were boiled at 100°C for 5 min. Electrophoresis was performed in 10% SDS-PAGE gels prior to transfer to polyvinylidene difluoride membranes for 1 hr at 40 V and 200 mA (transfer buffer: 15 mM Tris, 120 mM glycine, 20% methanol). Membranes were blocked for 1 hr in 3% bovine serum albumin (BSA) in Tris-Buffered Saline/Tween (TBST) (10 mM Tris, pH 8.0, 150 mM NaCl, 0.05% Tween). Membranes were immunoblotted overnight (1:800 in 5% BSA in TBST) with phospho-specific mouse antibody for p38 MAPK (p-p38) (New England BioLabs, Beverly, MA, USA). After being thoroughly washed in TBST, membranes were blotted with alkaline phosphatase-linked secondary goat anti-mouse antibody (New England BioLabs) (1:1000 in TBST) for 1 hr prior to color development with appropriate substrate (nitroblue tetrazolium [0.165 mg/mL] and 5'bromo-4'chloro-3'indolyl phosphate [0.165 mg/mL]) in buffer (100 mM Tris, pH 9.5, 100 mM NaCl, 5 mM MgCl2). Lysates were also blotted for total p38 MAPK (New England Biolabs) content for verification of equal amounts of p38 MAPK protein levels in each sample (data not shown). Lysates from serum-starved cultures constituted negative controls.

Analysis of IL-6 Gene Promoter and NF{kappa}B and C/EBPβ Activity
The full-length human IL-6 gene promoter (phIL-6) attached to the chloramphenicol transferase reporter gene was a generous gift of Dr. Stavros Manolagas (University of Arkansas). A 1.17-Kb fragment of phIL-6 spanning –1160 to +10 (relative to the transcription start site) was amplified by polymerase chain-reaction and subcloned into the firefly luciferase reporter gene-containing pGL-3 Basic vector (Promega, Madison, WI, USA). The resulting construct was termed phIL-6WT. Included in the anti-sense primer (5'-ATCTCGAGGGC AGAATGAGCCTCAGAC-3') sequence was a XhoI restriction site, and a SacI restriction site was included in the sense primer (5'-ATGAGCTCGGATCCTCCTGCAAGAGACA-3'). Two 5'-deletion constructs were generated to create –490 to +10 (hereafter phIL-6A) and a –260 to +10 (hereafter phIL-6B) promoter-reporter fragments. The same anti-sense primer was used to fabricate these 5'-deletion constructs. The sense primer used to generate the phIL-6A fragment was 5'-AGAGCTCGATGGAGTCAGAGGAAACTCAG-3'. For fabrication of phIL-6B, the sense primer was 5'-GCGAGCTCAGAAAGTAAAGGAAGAGTGGTT-3'. Both of these primers also contained a SacI restriction site. The C/EBPβ-sensitive promoter was generated as follows to include 4 C/EBPβ binding sites. A single primer set was generated with the following sense sequence: 5'ATAGAGCTCATACGTCACATTGCACAATCATAGAGCTCATTACGTCACATTGCACAATCATACAATACGTCACATTGCACAATCATTCATAACGTCACATTGCACAATCTAATCTCGAGTAA-3'. The anti-sense primer was as follows: 5'ATAC TCGAGGATTGTGCAATGTGACGTTTACTCGAGATTAGATTGTGCAATGTGACGTTATGAATGATTGTGCAATGTGACGTATTGTATGATTGTGCAATGTGACGTAATGAGCTCTAT-3'. The underlined areas correspond to the C/EBPβ binding site of the human IL-6 gene promoter. At the distal ends of the primers, a SacI restriction site was included, and a XhoI site was included at the proximal ends of the primers. After annealing and SacI/XhoI digestion, the fragment was ligated into pGL-3 per manufacturer's recommendations. Sequences for the phIL-6 constructs and the C/EBPβ construct were verified. The NF{kappa}B-luciferase construct was utilized as previously described (Pahan et al., 2000).

Transfection
MG-63 cells were plated in 35-mm plastic wells at a density of 4 x 105 cells/mL per well and incubated overnight in RPMI 1640 plus 10% FBS and antibiotics. Immediately prior to transfection, cells were washed 2 times in PBS. Cells in each well were transfected by means of 1-2 µg of plasmid DNA, 30 ng of control vector pRL-sv40 (Renilla luciferase), and 16 µg (8 µL) of LipofectAMINE reagent (Life Technologies, Inc., Gaithersburg, MD, USA) per manufacturer's recommendations. After 4-5 hrs, an equal volume of 20% FBS medium was added for an additional 16 hrs. Media were removed, and cells were incubated in serum-free media for 8 hrs, prior to replacement of media with 2 mL of media representative of experimental conditions (TNF with/without pre-incubation with SB203580 HCl for 60 min). After 24 hrs of TNF-{alpha} exposure, cells were washed in pre-cooled PBS and subjected to lysis in 400 µL of passive lysis buffer (Promega). Lysates were frozen, thawed, vortexed for 15 sec, and centrifuged for 20 sec at 10,000 x g. A 20-µL quantity of supernatant was mixed with 100 µL of luciferase assay buffer, and luciferase activity was measured as light output (10 sec) by a Turner Designs Luminometer Model TD 20/20 (Turner Designs, Sunnyvale, CA, USA). Subsequently, the Renilla luciferase activity was estimated after the addition of 100 µL of Stop and Glo reagent (Promega), and light output (10 sec) was measured separately. We used the Renilla activity to standardize the results for transfection efficiency. Each condition was run in triplicate, and the experiments were repeated at least two more times.

Statistics
We used analysis of variance to test whether TNF concentration and/or pre-incubation with inhibitor affected IL-6 secretion. For statistical analysis of luciferase activity, we used the Kruskal-Wallis test (for non-parametric data) to determine the effect of treatment condition (TNF-{alpha} concentration/inhibitor) on the ratio of firefly luciferase to Renilla luciferase. A p-value of less than 0.05 was assigned significance. Differences between group means were tested for statistical significance (p < 0.05) by appropriate post hoc tests.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To establish optimal concentrations for TNF-{alpha} stimulation, we incubated cells overnight with different doses of TNF-{alpha} (100, 10, 1 ng/mL) for 24 or 48 hrs. Interleukin-6 production by TNF-{alpha} was stimulated in MG-63 cells, in a time- and dose-dependent manner, as measured by ELISA (Fig. 2AGo), while pre-incubation with the p38 MAPK inhibitor SB203580HCl caused a statistically significant decrease in TNF-{alpha}-induced IL-6 secretion (Fig. 2BGo). Western blotting confirmed that TNF-{alpha} stimulation led to activation of the p38 MAPK pathway. Within 5 min, a rapid increase in levels of phosphorylated p38 MAPK was detected, after which levels gradually diminished (Fig. 3AGo). Additional experiments confirmed that SB203580 HCl inhibited phosphorylation of p38 MAPK (Fig. 3BGo).


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
Figure 2. TNF-{alpha} stimulates IL-6 secretion by MG-63 cells. (Panel A) Dose-response for 24-hour and 48-hour TNF-{alpha} stimulation. (Panel B) Secretion of IL-6 after pre-incubation with p38 MAPK inhibitor SB203580HCl for 1 hr prior to stimulation with TNF-{alpha} (20 ng/mL) for 24 hrs. *Statistically different from control (unstimulated) cultures (p < 0.05). Bars represent mean ± standard deviation (n = 4).

 

Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Figure 3. Activation of p38 MAPK by TNF-{alpha}. (Panel A) Time course (min) of TNF-{alpha} stimulation (20 ng/mL). (Panel B) Inhibition of p38 MAPK phosphorylation by SB203580 HCl. Cells serum-starved overnight, pre-incubated with SB203580HCl (10 µM) for 1 hr, followed by TNF-{alpha} stimulation (20 ng/mL) for 5 min.

 
To determine if activation of p38 MAPK led to enhanced IL-6 gene expression, we cloned the full-length IL-6 gene promoter into a reporter vector. TNF-{alpha} led to enhanced promoter activity in this model system, an effect that was reversed if cells were pre-incubated with SB203580 HCl (Fig. 4Go). Interestingly, the degree of inhibition of protein secretion was greater than that observed for gene expression. When two 5'-deletion constructs representing the proximal 490 bp and the proximal 260 bp of the IL-6 gene promoter were similarly stimulated, both promoter constructs responded similarly to the full-length promoter, indicating that elements responsible for TNF-{alpha} stimulation and for p38 MAPK effects resided in the proximal 260-bp segment of the IL-6 gene promoter (Fig. 4AGo).


Figure 4
View larger version (14K):
[in this window]
[in a new window]

 
Figure 4. TNF-{alpha} stimulates the IL-6 gene promoter via p38 MAPK, NF{kappa}B, and C/EBPβ. (Panel A) MG-63 cells were transiently transfected with respective plasmid (phIL-6 wild-type [phIL-6WT] or 5'-deletion constructs [phIL-6A and phIL-6B]), serum-starved for 24 hrs, and then stimulated with TNF-{alpha} (10 ng/mL) for 24 hrs. p38 MAPK inhibition was achieved by pre-incubation with SB203580HCl (10 µM) for 1 hr immediately prior to TNF-{alpha} stimulation (10 ng/mL). Luciferase activity within cell lysates was measured and corrected for transfection efficiency. *Statistically significant difference from TNF-{alpha}-stimulated cultures (p < 0.05). Bars represent mean ± standard deviation (n = 3), relative to control (unstimulated cultures). (Panel B) TNF-{alpha} modulates NF{kappa}B- and C/EBPβ-sensitive promoters via p38MAPK. Cells were transiently transfected with respective plasmid (or vector only), serum-starved for 24 hrs, and then stimulated with TNF-{alpha} (10 ng/mL) for 24 hrs. p38 MAPK inhibition was achieved by pre-incubation with SB203580HCl (10 µM) for 1 hr immediately prior to TNF-{alpha} stimulation. Luciferase activity within cell lysates was measured and corrected for transfection efficiency. *Statistically significant difference from control (unstimulated) cultures (p < 0.05). Bars represent mean ± standard deviation (n = 4).

 
Since previous reports have indicated that the proximal 260-bp segment contains two potentially important non-overlapping transcription factor binding sites, one each for C/EBPβ and for NF{kappa}B, we investigated whether TNF-{alpha} stimulated the activity of either of these transcription factors as evidenced by promoter/reporter constructs specifically sensitive to the activation of C/EBPβ or NF{kappa}B. Similarly to previous reports, TNF-{alpha} stimulated NF{kappa}B activity in a manner dependent upon p38 MAPK phosphorylation and was p38-MAPK-dependent. In contrast, however, basal C/EBPβ activity was inhibited by TNF-{alpha}, an effect that was reversed by the inhibition of p38 MAPK phosphorylation (Fig. 4BGo).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The induction by pro-inflammatory cytokines of interleukin-6 secretion by human osteoblasts is considered to play a significant role in inflammatory bone resorption (Manolagas, 1995). One such pro-inflammatory cytokine, TNF-{alpha}, is found in elevated concentrations in inflamed tissues adjacent to bone and induces IL-6 production by osteoblasts. The presence of IL-6 in the immediate vicinity of bone surfaces leads to the recruitment of osteoclast precursor cells (derived from monocyte cell lineage) as well as the initiation of differentiation of these precursor cells. Mature, multi-nucleated osteoclasts are, of course, the cell type responsible for the dissolution of bone. Therefore, by secreting IL-6 and predisposing to increased numbers of osteoclast precursor cells, osteoblasts are able to increase the rate of bone resorption at a given bone surface. Napoleon Bonaparte is reputed to have stated that "there are no bad armies, only bad generals". Therefore, to extend the analogy, osteoclasts constitute the army and osteoblasts act as the generals.

In preliminary experiments, using the MG-63 human osteosarcoma cell line, we showed that TNF-{alpha} induces IL-6 secretion into culture supernatants by these cells. Using an inhibitor specific to p38 MAPK, we showed further that this induction is, at least in part, due to activation of the p38 MAPK pathway, as measured by phosphorylation of p38 MAPK by its activator, MKK6 (MAP Kinase Kinase 6). In higher eukaryotes, 4 p38 MAPKs have been identified to date: p38{alpha}, p38β/p38β2, p38{gamma}/ERK6, and p38{delta}/SAPK4. All of these proteins can be activated by MKK6, while only some can be activated by MKK3 and MKK4 (Alonso et al., 2000).

We further determined that the proximal 260-bp region of the IL-6 gene promoter was responsive to p38 MAPK activation. The downstream substrates of the p38 MAPK pathway include various protein kinases, including MAPK-APK-2 and PRAK, as well as various transcription factors, such as NF{kappa}B, C/EBPs, MEF-2C, and ATF-2 (Schaeffer and Weber, 1999). Of these transcription factors, two have binding sites within the proximal 260 bp of the IL-6 gene promoter; specifically, an NF{kappa}B binding site is located between positions –73 and –63, and a C/EBPβ site is located between positions –173 and –145 relative to the transcription start site (Akira and Kishimoto, 1992). Although the NF{kappa}B binding site has been suggested to be the principal regulatory site for IL-6 gene expression, the C/EBPβ binding site also may influence the IL-6 gene response to pro-inflammatory cytokines (Merola et al., 1996; Galien and Garcia, 1997). Analysis of our data indicates that the deletion of a more distal AP-1 binding site (-283 to 277) does not alter the IL-6 gene promoter response to TNF-{alpha}, confirming previous reports that the AP-1 binding site does not confer responsiveness to pro-inflammatory cytokines and is likely associated with the response to growth factors (Ray et al., 1989; Eickelberg et al., 1999; Franchimont et al., 1999). However, it appears that TNF-{alpha} enhances functional activity of NF{kappa}B while slightly diminishing the activity of C/EBPβ relative to unstimulated cells. Of additional interest, both the NF{kappa}B activation and the C/EBPβ inhibition appear to be associated with activation of the p38 MAPK pathway, but to opposite effects. Whereas inhibition of the p38 MAPK pathway diminishes NF{kappa}B activation, it prevents the TNF-{alpha}-induced inhibition of C/EBPβ. However, it appears that, of the two effects, the activation of NF{kappa}B is dominant, since the net effect of TNF-{alpha} stimulation is enhanced IL-6 gene expression and enhanced IL-6 secretion. These findings are especially interesting in light of previous reports indicating that although the NF{kappa}B binding site within the IL-6 gene promoter is necessary for lipopolysaccharide or TNF-{alpha} responsiveness, its activity is dependent upon the presence of an intact C/EBPβ binding site (Merola et al., 1996; Hu et al., 2000) and interaction between the two factors.

MG-63 osteosarcoma cells represent a transformed cell line and, in cell culture, initially resemble immature osteoblasts but can be modulated to express the phenotype of a mature osteoblast. Therefore, inasmuch as the data presented were obtained from a cell line, our results should be interpreted with appropriate caution. However, it is important to recognize that the p38 MAP kinase pathway, investigated here and by others (Chae et al., 2001) in MG-63 cells, has been shown to be activated by cytokines in vivo (Kumar et al., 2001) as well as in vitro by other osteoblast-like cell lines (Blanque et al., 1997; Kozawa et al., 1999; Miwa et al., 1999), and also in primary chondrocyte cultures (Kumar et al., 2001). In general, our findings corroborate the role of TNF-{alpha} as a stimulator of p38 MAP kinase activity as reported by Kozawa et al. (1999) and by Miwa et al. (1999). That activated p38 MAP kinase activity leads to IL-6-induction-dependent NF{kappa}B function has also been recently reported by Chae et al. (2001). Furthermore, we also show that p38 MAP kinase activity regulates the activity of a c/EBPβ-responsive promoter in MG-63 cells. Previous reports have offered conflicting data in this regard. Caivano and Cohen (2000) noted that IL-1 induction of ERK1/2 and p38 MAP kinase had no effect on c/EBPβ function in RAW264 macrophages, whereas Baldassare et al. (1999) demonstrated that p38 MAP kinase stimulation in response to lipopolysaccharide led to enhanced c/EBPβ activity in RAW264.7 macrophages. However, neither of these reports focused on the role of p38 MAP kinase or c/EBPβ on IL-6 production.

The therapeutic potential of modulating MAP kinase-dependent IL-6 production by osteoblastic cells has risen with recent findings by Badger et al. (2000) and by Kumar et al. (2001). The former group demonstrated that joint integrity in rats with adjuvant-induced arthritis could be significantly improved by treatment with the p38 MAP kinase inhibitor SB242235, as reflected by a variety of measures including inflammation and bone mineral density. Of specific interest, serum IL-6 levels were significantly reduced in rats treated with SB242235. More recently, Kumar et al. (2001) have reported that the induction of IL-6 production and bone resorption by IL-1 and TNF-{alpha} in osteoblasts and chondrocytes could be inhibited by pre-treatment with SB203580. The authors conclude that there is a strong correlation between inhibition of p38 MAP kinase activity and inflammatory cytokine-stimulated biological responses as seen in joint diseases such as rheumatoid arthritis. These reports highlight the potential for alleviating the discomfort of bone/cartilage resorption-associated disease processes. However, it should be noted that IL-6 secretion was not completely inhibited in these studies or in those that we conducted, indicating that TNF-{alpha} uses other mechanisms by which to stimulate IL-6 gene expression and/or secretion. The most likely mechanism is via stimulation of the ERK pathway, and we (data not shown) and others have shown that ERK activation by inflammatory cytokines will promote IL-6 secretion in a manner similar to that promoted by p38 MAP kinase (Vanden Berghe et al., 1998; Miwa et al., 1999). Furthermore, in our experiments, inhibition of p38 MAP kinase led to a greater inhibition of protein secretion than of gene expression. Since p38 MAP kinase activation has been reported also to play a role in translation/protein synthesis, it is possible that inhibition of transcription and translation events would manifest when IL-6 secretion was measured, whereas only effects on transcription would be observed when gene expression was assessed. However, further study is needed for definitive determination of the reasons for the differences in effects on IL-6 secretion and gene expression.

In conclusion, our results indicate that p38 MAP kinase activity is increased in MG-63 cells in response to stimulation with TNF-{alpha}, and that the increased activity leads to enhanced IL-6 secretion, apparently as a result of enhanced NF{kappa}B activity, despite the fact that TNF-{alpha} may act to diminish the activity of C/EBPβ. These results may aid us in the search for a better understanding of the cellular and molecular mechanisms involved in IL-6 production in osteoblasts. In turn, a better understanding of the cellular and molecular mechanisms of inflammatory bone resorption will lead to the development of effective therapeutic strategies to prevent or minimize inflammatory bone loss.


    ACKNOWLEDGMENTS
 
This investigation was supported in part by the National Institute of Dental and Craniofacial Research (NIDCR), National Institutes of Health, grant DE12807, and by the University of Nebraska Medical Center College of Dentistry, Lincoln, NE. This manuscript is based in part on work presented in the AADR Caulk/Dentsply Student Research Group Competition during the 78th General Session of the International Association for Dental Research, March, 2000. The authors also acknowledge the efforts of Dr. Cade Hunzeker and Ms. Deanna Volle in preparation of this manuscript.

Received for publication October 12, 2000. Revision received November 14, 2001. Accepted for publication November 27, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS & METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  • Akira S, Kishimoto T (1992). IL-6 and NF-IL6 in acute phase response and viral infection. Immunol Rev 127:25–50.[CrossRef][Medline] [Order article via Infotrieve]
  • Alonso G, Ambrosino C, Jones M, Nebreda A (2000). Differential activation of p38 MAP kinase isoforms depending upon signal strength. J Biol Chem 275:40641–40648.[Abstract/Free Full Text]
  • Badger AM, Griswold DE, Kapadia R, Blake S, Swift BA, Hoffman SJ, et al. (2000). Disease-modifying activity of SB242235, a selective inhibitor of p38 mitogen-activated protein kinase, in rat adjuvant-induced arthritis. Arthritis Rheum 43:175–183.[CrossRef][Medline] [Order article via Infotrieve]
  • Baldassare JJ, Bi Y, Bellone CJ (1999). The role of p38 mitogen-activated protein kinase in IL-1 beta transcription. J Immunol 162:5367–5373.[Abstract/Free Full Text]
  • Blanque R, Cottereaux C, Gardner CR (1997). Effects of SK&F 86002 on cytokine-stimulated IL-6 production in cultured neonatal mouse calvaria and SaOS2 osteoblastic cells: the role of prostaglandins and other mechanisms of action. Drugs Exp Clin Res 23:63–70.[Medline] [Order article via Infotrieve]
  • Caivano M, Cohen P (2000). Role of mitogen-activated protein kinase cascades in mediating lipopolysaccharide-stimulated induction of cyclooxygenase-1 and IL-1 beta in RAW264 macrophages. J Immunol 164:3018–3025.[Abstract/Free Full Text]
  • Chae HJ, Chae SW, Chin HY, Bang BG, Cho SB, Han SK, et al. (2001).The p38 mitogen-activated protein kinase pathway regulates interleukin-6 synthesis in response to tumor necrosis factor in osteoblasts. Bone 28:45–53.
  • Chambers TJ, Fuller K (1985). Bone cells predispose bone surfaces to resorption by exposure of mineral to osteoclastic surfaces. J Cell Sci 76:155–165.[Abstract]
  • Chaudhary LR, Avioli LV (1997). Activation of extracellular signal-related kinases 1 and 2 by FGF-2 and PDGF-BB in normal human osteoblastic and bone marrow stromal cells: differences in mobility and in-gel renaturation of ERK1 in human, rat, and mouse osteoblastic cells. Biochem Biophys Res Commun 238:134–139.[CrossRef][Medline] [Order article via Infotrieve]
  • Chaudhary LR, Avioli LV (1998). Identification and activation of mitogen activated protein (MAP) kinase in normal human osteoblastic and bone marrow stromal cells: attenuation of MAP kinase activation by camp, parathyroid hormone and forskolin. Mol Cell Biochem 178:59–68.[CrossRef][Medline] [Order article via Infotrieve]
  • Eickelberg O, Pansky A, Mussmann R, Bihl M, Tamm M, Hildebrand P, et al. (1999). Transforming growth factor-beta1 induces interleukin-6 expression via activating protein-1 consisting of junD homodimers in primary human lung fibroblasts. J Biol Chem 274:12933–12938.[Abstract/Free Full Text]
  • Franchimont N, Durant D, Rydziel S, Canalis E (1999). Platelet-derived growth factor induces interleukin-6 transcription in osteoblasts through the activator protein-1 complex and activating transcription factor-2. J Biol Chem 274:6783–6789.[Abstract/Free Full Text]
  • Fuller K, Gallagher A, Chambers TJ (1991). Osteoclast resorption-stimulating activity is associated with osteoblast cells and/or the extracellular matrix. Biochem Biophys Res Commun 181:67–73.[CrossRef][Medline] [Order article via Infotrieve]
  • Galien R, Garcia T (1997). Estrogen receptor impairs interleukin-6 expression by preventing protein binding on the NF-kappaB site. Nucleic Acids Res 25:2424–2429.[Abstract/Free Full Text]
  • Hu HM, Tian Q, Baer M, Spooner CJ, Williams SC, Johnson PF, et al. (2000). The C/EBP bZIP domain can mediate lipopolysaccharide induction of the pro-inflammatory cytokines interleukin-6 and monocyte chemoattractant protein-1. J Biol Chem 275:16373–16381.[Abstract/Free Full Text]
  • Ishimi Y, Miyaura C, Jin CH, Akatsu T, Abe E, Nakamura Y, et al. (1990). IL-6 is produced by osteoblasts and induces bone resorption. J Immunol 145:3297–3303.[Abstract]
  • Kozawa O, Tokuda H, Matsuno H, Uematsu T (1999). Involvement of p38 mitogen-activated protein kinase in basic fibroblast growth factor-induced interleukin-6 synthesis in osteoblasts. J Cell Biochem 74:479–485.[CrossRef][Medline] [Order article via Infotrieve]
  • Kumar S, Votta BJ, Rieman DJ, Badger AM, Gowen M, Lee JC (2001). IL-1- and TNF-induced bone resorption is mediated by p38 mitogen activated protein kinase. J Cell Physiol 187:294–303.[CrossRef][Medline] [Order article via Infotrieve]
  • Latchman DS (1998). Eukaryotic transcription factors. 3rd ed. San Diego, CA: Academic Press.
  • Manolagas SC (1995). Role of cytokines in bone resorption. Bone 17:63S–67S.
  • Merola M, Blanchard B, Tovey MG (1996). The kappa B enhancer of the human interleukin-6 promoter is necessary and sufficient to confer an IL-1beta and TNF-alpha response in transfected human cell lines: requirement for members of the C/EBP family for activity. J Interferon Cyt Res 16:783–798.[Medline] [Order article via Infotrieve]
  • Miwa M, Kozawa O, Tokuda H, Uematsu T (1999). Mitogen-activated protein kinases are involved in interleukin-induced IL-6 synthesis in osteoblasts: modulation not of p38 MAP kinase, but of p42/p44 MAP kinase by IL-1-activated protein kinase C. Endocrinology 140:5120–5125.[Abstract/Free Full Text]
  • Miyazawa K, Mori A, Miyata H, Akahane M, Ajisawa Y, Okudaira H (1998). Regulation of interleukin-1β-induced interleukin-6 gene expression in human fibroblast-like synoviocytes by p38 mitogen activated protein kinase. J Biol Chem 273:24832–24838.[Abstract/Free Full Text]
  • Pahan K, Liu X, McKinney MJ, Wood C, Sheikh FG, Raymond JR (2000). Expression of dominant-negative mutant of p21(ras) inhibits induction of nitric oxide synthase and activation of nuclear factor-kappaB in primary astrocytes. J Neurochem 74:2288–2295.[CrossRef][Medline] [Order article via Infotrieve]
  • Ray A, Sassone-Corsi P, Sehgal PB (1989). A multiple cytokine- and second messenger-responsive element in the enhancer of the human interleukin-6 gene: similarities with c-fos regulation. Mol Cell Biol 9:5537–5547.[Abstract/Free Full Text]
  • Rozen N, Ish-Shalom S, Rachmiel A, Stein H, Lewinson D (2000). Interleukin-6 modulates trabecular and endochondral bone turnover in the nude mouse by stimulating osteoclast differentiation. Bone 26:469–474.
  • Schaeffer HJ, Weber MJ (1999). Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19:2435–2444.[Free Full Text]
  • Siddhanti SR, Hartle JE, Quarles LD (1995). Forskolin inhibits protein kinase C-induced mitogen activated protein kinase activity in MC3T3-E1 osteoblasts. Endocrinology 136:4834–4841.[Abstract]
  • Thomson BM, Mundy GR, Chambers TJ (1987). Tumor necrosis factors alpha and beta induce osteoblastic cells to stimulate osteoclastic bone resorption. J Immunol 138:775–779.[Abstract]
  • Thomson S, Mahadevan LC, Clayton AC (1999). MAP kinase-mediated signalling to nucleosomes and immediate-early gene induction. Sem Cell Dev Biol 10:205–214.[CrossRef][Medline] [Order article via Infotrieve]
  • Vanden Berghe W, Plaisance S, Boone E, De Bosscher K, Schmitz ML, Fiers W, et al. (1998). p38 and extracellular signal-related kinase mitogen activated protein kinase pathways are required for nuclear factor-{kappa}B p65 transactivation mediated by tumor necrosis factor. J Biol Chem 273:3285–3290.[Abstract/Free Full Text]
  • Vanden Berghe W, Vermuelen L, De Wilde G, De Bosscher K, Boone E, Haegeman G (2000). Signal transduction by tumor necrosis factor and gene regulation of the inflammatory cytokine interleukin-6. Biochem Pharmacol 60:1185–1195.[CrossRef][Medline] [Order article via Infotrieve]
  • Verheijen MH, Defize LH (1995). Parathyroid hormone inhibits mitogen-activated protein kinase activation in osteosarcoma cells via a protein kinase A-dependent pathway. Endocrinology 136:3331–3337.[Abstract]

Journal of Dental Research, Vol. 81, No. 1, 17-22 (2002)
DOI: 10.1177/154405910208100105


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
BloodHome page
A. Karadag, M. Zhou, and P. I. Croucher
ADAM-9 (MDC-9/meltrin-{gamma}), a member of the a disintegrin and metalloproteinase family, regulates myeloma-cell-induced interleukin-6 production in osteoblasts by direct interaction with the {alpha}vbeta5 integrin
Blood, April 15, 2006; 107(8): 3271 - 3278.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Iwasaki, M. Asai, M. Yoshida, T. Nigawara, M. Kambayashi, and N. Nakashima
Dehydroepiandrosterone-Sulfate Inhibits Nuclear Factor-{kappa}B-Dependent Transcription in Hepatocytes, Possibly through Antioxidant Effect
J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3449 - 3454.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Saved Citations
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Request Reprints
Right arrow Add to My Marked Citations
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Right arrow Citing Articles via Scopus
Google Scholar
Right arrow Articles by Webb, S.J.
Right arrow Articles by Koka, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Webb, S.J.
Right arrow Articles by Koka, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?